ID: 961340355

View in Genome Browser
Species Human (GRCh38)
Location 3:126213209-126213231
Sequence CGGACAAAGCACTCTGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340355_961340358 1 Left 961340355 3:126213209-126213231 CCGCAGCCAGAGTGCTTTGTCCG No data
Right 961340358 3:126213233-126213255 GCTCAAAAAAGCCGTCTCCATGG No data
961340355_961340362 20 Left 961340355 3:126213209-126213231 CCGCAGCCAGAGTGCTTTGTCCG No data
Right 961340362 3:126213252-126213274 ATGGAAGCGGCCCTTCCGCTCGG No data
961340355_961340363 27 Left 961340355 3:126213209-126213231 CCGCAGCCAGAGTGCTTTGTCCG No data
Right 961340363 3:126213259-126213281 CGGCCCTTCCGCTCGGAGCCCGG No data
961340355_961340365 30 Left 961340355 3:126213209-126213231 CCGCAGCCAGAGTGCTTTGTCCG No data
Right 961340365 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
961340355_961340359 7 Left 961340355 3:126213209-126213231 CCGCAGCCAGAGTGCTTTGTCCG No data
Right 961340359 3:126213239-126213261 AAAAGCCGTCTCCATGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340355 Original CRISPR CGGACAAAGCACTCTGGCTG CGG (reversed) Intergenic