ID: 961340357

View in Genome Browser
Species Human (GRCh38)
Location 3:126213229-126213251
Sequence GGAGACGGCTTTTTTGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340357_961340373 27 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data
961340357_961340369 18 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340369 3:126213270-126213292 CTCGGAGCCCGGCGGCCTGGAGG No data
961340357_961340374 30 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG No data
961340357_961340370 19 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340370 3:126213271-126213293 TCGGAGCCCGGCGGCCTGGAGGG No data
961340357_961340365 10 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340365 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
961340357_961340368 15 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340368 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
961340357_961340362 0 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340362 3:126213252-126213274 ATGGAAGCGGCCCTTCCGCTCGG No data
961340357_961340363 7 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340363 3:126213259-126213281 CGGCCCTTCCGCTCGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340357 Original CRISPR GGAGACGGCTTTTTTGAGCT CGG (reversed) Intergenic