ID: 961340360

View in Genome Browser
Species Human (GRCh38)
Location 3:126213244-126213266
Sequence AAGGGCCGCTTCCATGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340360_961340370 4 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340370 3:126213271-126213293 TCGGAGCCCGGCGGCCTGGAGGG No data
961340360_961340363 -8 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340363 3:126213259-126213281 CGGCCCTTCCGCTCGGAGCCCGG No data
961340360_961340365 -5 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340365 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
961340360_961340375 16 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340375 3:126213283-126213305 GGCCTGGAGGGAGACCCGGCGGG No data
961340360_961340368 0 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340368 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
961340360_961340376 17 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340376 3:126213284-126213306 GCCTGGAGGGAGACCCGGCGGGG No data
961340360_961340369 3 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340369 3:126213270-126213292 CTCGGAGCCCGGCGGCCTGGAGG No data
961340360_961340378 25 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340360_961340373 12 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data
961340360_961340374 15 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340360 Original CRISPR AAGGGCCGCTTCCATGGAGA CGG (reversed) Intergenic