ID: 961340361

View in Genome Browser
Species Human (GRCh38)
Location 3:126213250-126213272
Sequence GAGCGGAAGGGCCGCTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340361_961340375 10 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340375 3:126213283-126213305 GGCCTGGAGGGAGACCCGGCGGG No data
961340361_961340378 19 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340361_961340374 9 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG No data
961340361_961340370 -2 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340370 3:126213271-126213293 TCGGAGCCCGGCGGCCTGGAGGG No data
961340361_961340373 6 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data
961340361_961340368 -6 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340368 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
961340361_961340369 -3 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340369 3:126213270-126213292 CTCGGAGCCCGGCGGCCTGGAGG No data
961340361_961340376 11 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340376 3:126213284-126213306 GCCTGGAGGGAGACCCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340361 Original CRISPR GAGCGGAAGGGCCGCTTCCA TGG (reversed) Intergenic
No off target data available for this crispr