ID: 961340363

View in Genome Browser
Species Human (GRCh38)
Location 3:126213259-126213281
Sequence CGGCCCTTCCGCTCGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340355_961340363 27 Left 961340355 3:126213209-126213231 CCGCAGCCAGAGTGCTTTGTCCG No data
Right 961340363 3:126213259-126213281 CGGCCCTTCCGCTCGGAGCCCGG No data
961340357_961340363 7 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340363 3:126213259-126213281 CGGCCCTTCCGCTCGGAGCCCGG No data
961340356_961340363 21 Left 961340356 3:126213215-126213237 CCAGAGTGCTTTGTCCGAGCTCA No data
Right 961340363 3:126213259-126213281 CGGCCCTTCCGCTCGGAGCCCGG No data
961340360_961340363 -8 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340363 3:126213259-126213281 CGGCCCTTCCGCTCGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340363 Original CRISPR CGGCCCTTCCGCTCGGAGCC CGG Intergenic