ID: 961340365

View in Genome Browser
Species Human (GRCh38)
Location 3:126213262-126213284
Sequence CCCTTCCGCTCGGAGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340356_961340365 24 Left 961340356 3:126213215-126213237 CCAGAGTGCTTTGTCCGAGCTCA No data
Right 961340365 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
961340355_961340365 30 Left 961340355 3:126213209-126213231 CCGCAGCCAGAGTGCTTTGTCCG No data
Right 961340365 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
961340357_961340365 10 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340365 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
961340360_961340365 -5 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340365 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340365 Original CRISPR CCCTTCCGCTCGGAGCCCGG CGG Intergenic