ID: 961340366

View in Genome Browser
Species Human (GRCh38)
Location 3:126213263-126213285
Sequence GCCGCCGGGCTCCGAGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340366_961340375 -3 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340375 3:126213283-126213305 GGCCTGGAGGGAGACCCGGCGGG No data
961340366_961340376 -2 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340376 3:126213284-126213306 GCCTGGAGGGAGACCCGGCGGGG No data
961340366_961340373 -7 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data
961340366_961340378 6 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340366_961340381 27 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340366_961340374 -4 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340366 Original CRISPR GCCGCCGGGCTCCGAGCGGA AGG (reversed) Intergenic