ID: 961340368

View in Genome Browser
Species Human (GRCh38)
Location 3:126213267-126213289
Sequence CCGCTCGGAGCCCGGCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340356_961340368 29 Left 961340356 3:126213215-126213237 CCAGAGTGCTTTGTCCGAGCTCA No data
Right 961340368 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
961340361_961340368 -6 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340368 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
961340357_961340368 15 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340368 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
961340360_961340368 0 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340368 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340368 Original CRISPR CCGCTCGGAGCCCGGCGGCC TGG Intergenic