ID: 961340369

View in Genome Browser
Species Human (GRCh38)
Location 3:126213270-126213292
Sequence CTCGGAGCCCGGCGGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340361_961340369 -3 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340369 3:126213270-126213292 CTCGGAGCCCGGCGGCCTGGAGG No data
961340360_961340369 3 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340369 3:126213270-126213292 CTCGGAGCCCGGCGGCCTGGAGG No data
961340357_961340369 18 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340369 3:126213270-126213292 CTCGGAGCCCGGCGGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340369 Original CRISPR CTCGGAGCCCGGCGGCCTGG AGG Intergenic