ID: 961340370

View in Genome Browser
Species Human (GRCh38)
Location 3:126213271-126213293
Sequence TCGGAGCCCGGCGGCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340360_961340370 4 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340370 3:126213271-126213293 TCGGAGCCCGGCGGCCTGGAGGG No data
961340361_961340370 -2 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340370 3:126213271-126213293 TCGGAGCCCGGCGGCCTGGAGGG No data
961340357_961340370 19 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340370 3:126213271-126213293 TCGGAGCCCGGCGGCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340370 Original CRISPR TCGGAGCCCGGCGGCCTGGA GGG Intergenic