ID: 961340371

View in Genome Browser
Species Human (GRCh38)
Location 3:126213277-126213299
Sequence GGGTCTCCCTCCAGGCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340371_961340378 -8 Left 961340371 3:126213277-126213299 CCCGGCGGCCTGGAGGGAGACCC No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340371_961340381 13 Left 961340371 3:126213277-126213299 CCCGGCGGCCTGGAGGGAGACCC No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340371_961340386 22 Left 961340371 3:126213277-126213299 CCCGGCGGCCTGGAGGGAGACCC No data
Right 961340386 3:126213322-126213344 CCCAGCCCCAGAGGACGCGGCGG No data
961340371_961340383 19 Left 961340371 3:126213277-126213299 CCCGGCGGCCTGGAGGGAGACCC No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340371 Original CRISPR GGGTCTCCCTCCAGGCCGCC GGG (reversed) Intergenic