ID: 961340372

View in Genome Browser
Species Human (GRCh38)
Location 3:126213278-126213300
Sequence CGGGTCTCCCTCCAGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340372_961340378 -9 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340372_961340391 30 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340391 3:126213331-126213353 AGAGGACGCGGCGGAGAGCCTGG No data
961340372_961340386 21 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340386 3:126213322-126213344 CCCAGCCCCAGAGGACGCGGCGG No data
961340372_961340383 18 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data
961340372_961340381 12 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340372 Original CRISPR CGGGTCTCCCTCCAGGCCGC CGG (reversed) Intergenic