ID: 961340373

View in Genome Browser
Species Human (GRCh38)
Location 3:126213279-126213301
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340364_961340373 -6 Left 961340364 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data
961340360_961340373 12 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data
961340357_961340373 27 Left 961340357 3:126213229-126213251 CCGAGCTCAAAAAAGCCGTCTCC No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data
961340361_961340373 6 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data
961340366_961340373 -7 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr