ID: 961340375

View in Genome Browser
Species Human (GRCh38)
Location 3:126213283-126213305
Sequence GGCCTGGAGGGAGACCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340361_961340375 10 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340375 3:126213283-126213305 GGCCTGGAGGGAGACCCGGCGGG No data
961340367_961340375 -7 Left 961340367 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
Right 961340375 3:126213283-126213305 GGCCTGGAGGGAGACCCGGCGGG No data
961340364_961340375 -2 Left 961340364 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
Right 961340375 3:126213283-126213305 GGCCTGGAGGGAGACCCGGCGGG No data
961340360_961340375 16 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340375 3:126213283-126213305 GGCCTGGAGGGAGACCCGGCGGG No data
961340366_961340375 -3 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340375 3:126213283-126213305 GGCCTGGAGGGAGACCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340375 Original CRISPR GGCCTGGAGGGAGACCCGGC GGG Intergenic