ID: 961340378

View in Genome Browser
Species Human (GRCh38)
Location 3:126213292-126213314
Sequence GGAGACCCGGCGGGGATGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340360_961340378 25 Left 961340360 3:126213244-126213266 CCGTCTCCATGGAAGCGGCCCTT No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340361_961340378 19 Left 961340361 3:126213250-126213272 CCATGGAAGCGGCCCTTCCGCTC No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340367_961340378 2 Left 961340367 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340372_961340378 -9 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340371_961340378 -8 Left 961340371 3:126213277-126213299 CCCGGCGGCCTGGAGGGAGACCC No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340364_961340378 7 Left 961340364 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data
961340366_961340378 6 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340378 3:126213292-126213314 GGAGACCCGGCGGGGATGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340378 Original CRISPR GGAGACCCGGCGGGGATGCG AGG Intergenic
No off target data available for this crispr