ID: 961340379

View in Genome Browser
Species Human (GRCh38)
Location 3:126213297-126213319
Sequence GGAATCCTCGCATCCCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340379_961340383 -1 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data
961340379_961340392 14 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340392 3:126213334-126213356 GGACGCGGCGGAGAGCCTGGAGG No data
961340379_961340391 11 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340391 3:126213331-126213353 AGAGGACGCGGCGGAGAGCCTGG No data
961340379_961340386 2 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340386 3:126213322-126213344 CCCAGCCCCAGAGGACGCGGCGG No data
961340379_961340393 17 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340393 3:126213337-126213359 CGCGGCGGAGAGCCTGGAGGAGG No data
961340379_961340381 -7 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340379 Original CRISPR GGAATCCTCGCATCCCCGCC GGG (reversed) Intergenic