ID: 961340381

View in Genome Browser
Species Human (GRCh38)
Location 3:126213313-126213335
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340371_961340381 13 Left 961340371 3:126213277-126213299 CCCGGCGGCCTGGAGGGAGACCC No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340367_961340381 23 Left 961340367 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340379_961340381 -7 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340377_961340381 5 Left 961340377 3:126213285-126213307 CCTGGAGGGAGACCCGGCGGGGA No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340380_961340381 -8 Left 961340380 3:126213298-126213320 CCGGCGGGGATGCGAGGATTCCG No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340366_961340381 27 Left 961340366 3:126213263-126213285 CCTTCCGCTCGGAGCCCGGCGGC No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340364_961340381 28 Left 961340364 3:126213262-126213284 CCCTTCCGCTCGGAGCCCGGCGG No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data
961340372_961340381 12 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340381 3:126213313-126213335 GGATTCCGCCCCAGCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type