ID: 961340383

View in Genome Browser
Species Human (GRCh38)
Location 3:126213319-126213341
Sequence CGCCCCAGCCCCAGAGGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340377_961340383 11 Left 961340377 3:126213285-126213307 CCTGGAGGGAGACCCGGCGGGGA No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data
961340380_961340383 -2 Left 961340380 3:126213298-126213320 CCGGCGGGGATGCGAGGATTCCG No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data
961340379_961340383 -1 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data
961340371_961340383 19 Left 961340371 3:126213277-126213299 CCCGGCGGCCTGGAGGGAGACCC No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data
961340372_961340383 18 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data
961340367_961340383 29 Left 961340367 3:126213267-126213289 CCGCTCGGAGCCCGGCGGCCTGG No data
Right 961340383 3:126213319-126213341 CGCCCCAGCCCCAGAGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340383 Original CRISPR CGCCCCAGCCCCAGAGGACG CGG Intergenic