ID: 961340386

View in Genome Browser
Species Human (GRCh38)
Location 3:126213322-126213344
Sequence CCCAGCCCCAGAGGACGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340379_961340386 2 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340386 3:126213322-126213344 CCCAGCCCCAGAGGACGCGGCGG No data
961340371_961340386 22 Left 961340371 3:126213277-126213299 CCCGGCGGCCTGGAGGGAGACCC No data
Right 961340386 3:126213322-126213344 CCCAGCCCCAGAGGACGCGGCGG No data
961340377_961340386 14 Left 961340377 3:126213285-126213307 CCTGGAGGGAGACCCGGCGGGGA No data
Right 961340386 3:126213322-126213344 CCCAGCCCCAGAGGACGCGGCGG No data
961340372_961340386 21 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340386 3:126213322-126213344 CCCAGCCCCAGAGGACGCGGCGG No data
961340380_961340386 1 Left 961340380 3:126213298-126213320 CCGGCGGGGATGCGAGGATTCCG No data
Right 961340386 3:126213322-126213344 CCCAGCCCCAGAGGACGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340386 Original CRISPR CCCAGCCCCAGAGGACGCGG CGG Intergenic