ID: 961340391

View in Genome Browser
Species Human (GRCh38)
Location 3:126213331-126213353
Sequence AGAGGACGCGGCGGAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340377_961340391 23 Left 961340377 3:126213285-126213307 CCTGGAGGGAGACCCGGCGGGGA No data
Right 961340391 3:126213331-126213353 AGAGGACGCGGCGGAGAGCCTGG No data
961340382_961340391 -10 Left 961340382 3:126213318-126213340 CCGCCCCAGCCCCAGAGGACGCG No data
Right 961340391 3:126213331-126213353 AGAGGACGCGGCGGAGAGCCTGG No data
961340380_961340391 10 Left 961340380 3:126213298-126213320 CCGGCGGGGATGCGAGGATTCCG No data
Right 961340391 3:126213331-126213353 AGAGGACGCGGCGGAGAGCCTGG No data
961340379_961340391 11 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340391 3:126213331-126213353 AGAGGACGCGGCGGAGAGCCTGG No data
961340372_961340391 30 Left 961340372 3:126213278-126213300 CCGGCGGCCTGGAGGGAGACCCG No data
Right 961340391 3:126213331-126213353 AGAGGACGCGGCGGAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340391 Original CRISPR AGAGGACGCGGCGGAGAGCC TGG Intergenic