ID: 961340392

View in Genome Browser
Species Human (GRCh38)
Location 3:126213334-126213356
Sequence GGACGCGGCGGAGAGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340382_961340392 -7 Left 961340382 3:126213318-126213340 CCGCCCCAGCCCCAGAGGACGCG No data
Right 961340392 3:126213334-126213356 GGACGCGGCGGAGAGCCTGGAGG No data
961340380_961340392 13 Left 961340380 3:126213298-126213320 CCGGCGGGGATGCGAGGATTCCG No data
Right 961340392 3:126213334-126213356 GGACGCGGCGGAGAGCCTGGAGG No data
961340384_961340392 -10 Left 961340384 3:126213321-126213343 CCCCAGCCCCAGAGGACGCGGCG No data
Right 961340392 3:126213334-126213356 GGACGCGGCGGAGAGCCTGGAGG No data
961340379_961340392 14 Left 961340379 3:126213297-126213319 CCCGGCGGGGATGCGAGGATTCC No data
Right 961340392 3:126213334-126213356 GGACGCGGCGGAGAGCCTGGAGG No data
961340377_961340392 26 Left 961340377 3:126213285-126213307 CCTGGAGGGAGACCCGGCGGGGA No data
Right 961340392 3:126213334-126213356 GGACGCGGCGGAGAGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340392 Original CRISPR GGACGCGGCGGAGAGCCTGG AGG Intergenic