ID: 961340570

View in Genome Browser
Species Human (GRCh38)
Location 3:126214244-126214266
Sequence AGGCATTGGAAGCCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961340570_961340577 -3 Left 961340570 3:126214244-126214266 CCCTTCCCAGGCTTCCAATGCCT No data
Right 961340577 3:126214264-126214286 CCTCGCCCCCTGCTGTGGTAAGG No data
961340570_961340584 28 Left 961340570 3:126214244-126214266 CCCTTCCCAGGCTTCCAATGCCT No data
Right 961340584 3:126214295-126214317 TGGTCCCTATTTATTAATCAGGG No data
961340570_961340583 27 Left 961340570 3:126214244-126214266 CCCTTCCCAGGCTTCCAATGCCT No data
Right 961340583 3:126214294-126214316 CTGGTCCCTATTTATTAATCAGG No data
961340570_961340575 -8 Left 961340570 3:126214244-126214266 CCCTTCCCAGGCTTCCAATGCCT No data
Right 961340575 3:126214259-126214281 CAATGCCTCGCCCCCTGCTGTGG No data
961340570_961340582 8 Left 961340570 3:126214244-126214266 CCCTTCCCAGGCTTCCAATGCCT No data
Right 961340582 3:126214275-126214297 GCTGTGGTAAGGATTCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961340570 Original CRISPR AGGCATTGGAAGCCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr