ID: 961344172

View in Genome Browser
Species Human (GRCh38)
Location 3:126251122-126251144
Sequence ACTAGTTTTTATACATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961344172_961344181 11 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344181 3:126251156-126251178 CCCCATGGGCACATGTTCTCAGG No data
961344172_961344186 23 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG 0: 41
1: 166
2: 469
3: 387
4: 410
961344172_961344175 -4 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344175 3:126251141-126251163 TAGTTGTGGCCCAACCCCCATGG No data
961344172_961344183 12 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344183 3:126251157-126251179 CCCATGGGCACATGTTCTCAGGG No data
961344172_961344176 -3 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344176 3:126251142-126251164 AGTTGTGGCCCAACCCCCATGGG No data
961344172_961344185 22 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344185 3:126251167-126251189 CATGTTCTCAGGGTCTCCTGAGG 0: 46
1: 209
2: 641
3: 795
4: 1294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961344172 Original CRISPR ACTAGTTTTTATACATTTTA GGG (reversed) Intergenic
No off target data available for this crispr