ID: 961344175

View in Genome Browser
Species Human (GRCh38)
Location 3:126251141-126251163
Sequence TAGTTGTGGCCCAACCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961344171_961344175 -3 Left 961344171 3:126251121-126251143 CCCCTAAAATGTATAAAAACTAG No data
Right 961344175 3:126251141-126251163 TAGTTGTGGCCCAACCCCCATGG No data
961344173_961344175 -5 Left 961344173 3:126251123-126251145 CCTAAAATGTATAAAAACTAGTT No data
Right 961344175 3:126251141-126251163 TAGTTGTGGCCCAACCCCCATGG No data
961344172_961344175 -4 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344175 3:126251141-126251163 TAGTTGTGGCCCAACCCCCATGG No data
961344170_961344175 -2 Left 961344170 3:126251120-126251142 CCCCCTAAAATGTATAAAAACTA No data
Right 961344175 3:126251141-126251163 TAGTTGTGGCCCAACCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961344175 Original CRISPR TAGTTGTGGCCCAACCCCCA TGG Intergenic
No off target data available for this crispr