ID: 961344185

View in Genome Browser
Species Human (GRCh38)
Location 3:126251167-126251189
Sequence CATGTTCTCAGGGTCTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2985
Summary {0: 46, 1: 209, 2: 641, 3: 795, 4: 1294}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961344171_961344185 23 Left 961344171 3:126251121-126251143 CCCCTAAAATGTATAAAAACTAG No data
Right 961344185 3:126251167-126251189 CATGTTCTCAGGGTCTCCTGAGG 0: 46
1: 209
2: 641
3: 795
4: 1294
961344173_961344185 21 Left 961344173 3:126251123-126251145 CCTAAAATGTATAAAAACTAGTT No data
Right 961344185 3:126251167-126251189 CATGTTCTCAGGGTCTCCTGAGG 0: 46
1: 209
2: 641
3: 795
4: 1294
961344177_961344185 -6 Left 961344177 3:126251150-126251172 CCCAACCCCCATGGGCACATGTT No data
Right 961344185 3:126251167-126251189 CATGTTCTCAGGGTCTCCTGAGG 0: 46
1: 209
2: 641
3: 795
4: 1294
961344172_961344185 22 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344185 3:126251167-126251189 CATGTTCTCAGGGTCTCCTGAGG 0: 46
1: 209
2: 641
3: 795
4: 1294
961344170_961344185 24 Left 961344170 3:126251120-126251142 CCCCCTAAAATGTATAAAAACTA No data
Right 961344185 3:126251167-126251189 CATGTTCTCAGGGTCTCCTGAGG 0: 46
1: 209
2: 641
3: 795
4: 1294
961344178_961344185 -7 Left 961344178 3:126251151-126251173 CCAACCCCCATGGGCACATGTTC No data
Right 961344185 3:126251167-126251189 CATGTTCTCAGGGTCTCCTGAGG 0: 46
1: 209
2: 641
3: 795
4: 1294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961344185 Original CRISPR CATGTTCTCAGGGTCTCCTG AGG Intergenic
Too many off-targets to display for this crispr