ID: 961344186

View in Genome Browser
Species Human (GRCh38)
Location 3:126251168-126251190
Sequence ATGTTCTCAGGGTCTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1473
Summary {0: 41, 1: 166, 2: 469, 3: 387, 4: 410}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961344173_961344186 22 Left 961344173 3:126251123-126251145 CCTAAAATGTATAAAAACTAGTT No data
Right 961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG 0: 41
1: 166
2: 469
3: 387
4: 410
961344177_961344186 -5 Left 961344177 3:126251150-126251172 CCCAACCCCCATGGGCACATGTT No data
Right 961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG 0: 41
1: 166
2: 469
3: 387
4: 410
961344171_961344186 24 Left 961344171 3:126251121-126251143 CCCCTAAAATGTATAAAAACTAG No data
Right 961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG 0: 41
1: 166
2: 469
3: 387
4: 410
961344179_961344186 -10 Left 961344179 3:126251155-126251177 CCCCCATGGGCACATGTTCTCAG No data
Right 961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG 0: 41
1: 166
2: 469
3: 387
4: 410
961344170_961344186 25 Left 961344170 3:126251120-126251142 CCCCCTAAAATGTATAAAAACTA No data
Right 961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG 0: 41
1: 166
2: 469
3: 387
4: 410
961344172_961344186 23 Left 961344172 3:126251122-126251144 CCCTAAAATGTATAAAAACTAGT No data
Right 961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG 0: 41
1: 166
2: 469
3: 387
4: 410
961344178_961344186 -6 Left 961344178 3:126251151-126251173 CCAACCCCCATGGGCACATGTTC No data
Right 961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG 0: 41
1: 166
2: 469
3: 387
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961344186 Original CRISPR ATGTTCTCAGGGTCTCCTGA GGG Intergenic
900033612 1:389047-389069 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
900054447 1:618937-618959 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
900721167 1:4176703-4176725 CTGTTCTCAGGATCTCCTGAGGG + Intergenic
900891407 1:5452215-5452237 CTGTTCCCAGGACCTCCTGAGGG - Intergenic
901411179 1:9085230-9085252 ATGTTCTCAGAACCCCCTGAGGG - Intronic
902072592 1:13753342-13753364 ATATTCTCAGGCACTACTGACGG - Intronic
902429890 1:16354695-16354717 ATGTTCTCAGGATCTCCCAAGGG + Intronic
902978278 1:20105098-20105120 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
903054821 1:20628426-20628448 ATATTCTCAGAATCTCCTGAGGG + Intergenic
903137895 1:21321290-21321312 CTGTTATCTGGGCCTCCTGAAGG - Intronic
903207040 1:21790294-21790316 ATGTTCTCAGGAGCTCCTGAGGG + Intergenic
903392586 1:22975061-22975083 ATAATCTCAGGACCTCCTGAGGG + Intergenic
903840637 1:26236719-26236741 ACGTTATCAGGATCACCTGAGGG - Intronic
904387556 1:30153947-30153969 ATGCTCTCAGGACTTCCTGAGGG - Intergenic
904394566 1:30210097-30210119 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
904712204 1:32438733-32438755 ATGTTTTCAGGATCTCCTGGGGG + Intergenic
905025236 1:34845172-34845194 ATCATCTCAGGGTCCTCTGATGG - Intronic
905235383 1:36542737-36542759 CTGTTCCCTGGGACTCCTGAGGG - Intergenic
906631974 1:47379024-47379046 TTGTTCTCAGGATCTCCTAAGGG - Intergenic
906722392 1:48018436-48018458 ATGTTCTCAGGGCTTGGTGAGGG + Intergenic
907604809 1:55805899-55805921 GTGTTCCCAGGGGCACCTGATGG + Intergenic
908160597 1:61404201-61404223 ATTCTTTCAGCGTCTCCTGAGGG - Exonic
908788863 1:67761460-67761482 GTGTCCTCAGGCTCTCATGAAGG + Intronic
908910159 1:69063846-69063868 ATGTTCTCAGGACCTCCTGAAGG - Intergenic
909013965 1:70363788-70363810 ATGTTCTCAGGACCTCCTGAGGG - Intronic
909027176 1:70495430-70495452 ATGTTCTCAGGATCTCCCGAGGG + Intergenic
909455165 1:75841990-75842012 ATGTTCTCAGGACCTCCTGAGGG - Intronic
909857033 1:80548065-80548087 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
910145217 1:84072006-84072028 ATGTTCTCAGGGCCTCCTGAGGG - Intergenic
910401672 1:86843575-86843597 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
911023582 1:93413152-93413174 ATGTTCTCAGGACCTCCTGATGG - Intergenic
911028516 1:93460567-93460589 ATGTTTTCAGGATCTCCTGTGGG + Intronic
911107651 1:94149045-94149067 ATGTTCTAAGGACCTCCTGAGGG - Intronic
911167191 1:94734787-94734809 AGGTTCTCAGGACCTCCTGAGGG + Intergenic
911539264 1:99138763-99138785 ATGTTCTCAAGACTTCCTGAGGG + Intergenic
911991670 1:104705912-104705934 ATGTCCTCAGGACTTCCTGAGGG + Intergenic
912620440 1:111151064-111151086 GTGTTCTCAGGACCTCCTGAGGG - Intronic
912627235 1:111215544-111215566 ATGTTCTCAGGATCTCCTGAGGG + Intronic
912810684 1:112792087-112792109 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
912938712 1:114025905-114025927 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
913051177 1:115117881-115117903 ATGTTTTCAGGATTTCCTGAGGG + Intergenic
913112754 1:115671155-115671177 TGGTTTTCATGGTCTCCTGAGGG + Intronic
913669145 1:121079040-121079062 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
914020890 1:143866437-143866459 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
914425362 1:147571053-147571075 ATGTTCTCAGGGGCACCTGGTGG - Intronic
914659387 1:149774379-149774401 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
914930715 1:151930128-151930150 ATGTTCTTAGCGTCTCTTAAGGG + Intergenic
915207650 1:154282479-154282501 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
915208585 1:154288927-154288949 AGGTTCTCAGGACTTCCTGAGGG - Intergenic
915554123 1:156652016-156652038 ATGTTCTCCGGGGCTAATGATGG + Intronic
915672431 1:157501607-157501629 ATGTTCTTAGGACCTCCTGAGGG - Intergenic
915846147 1:159267273-159267295 ATGTTCTCAGAACCTCCTGAGGG + Intergenic
915880570 1:159667090-159667112 ATGTTCTCAGGACCACCTGAGGG - Intergenic
915881042 1:159671557-159671579 ATGTTCTCAGGACCTCCTTGAGG - Intergenic
915892842 1:159787618-159787640 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
916226769 1:162496919-162496941 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
917117926 1:171621158-171621180 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
917150919 1:171943748-171943770 ATGTTTTCAGGATCTCCTGAGGG + Intronic
917210149 1:172622943-172622965 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
917449818 1:175138130-175138152 ATGTACTCAAGGACCCCTGATGG + Intronic
917458316 1:175204954-175204976 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
918289413 1:183092379-183092401 ATGTTCTCGGGATCTCCTAAGGG + Intronic
918460801 1:184774669-184774691 ATGTTCTCAAGACCTCCTGAGGG + Intergenic
918853618 1:189722695-189722717 ATATTCTCAGGGTCTCCTGAGGG + Intergenic
918968515 1:191381713-191381735 ATGTTTTCAGGACCTCCTGAGGG + Intergenic
919143369 1:193601805-193601827 CTTTTCTCAGTGACTCCTGAGGG + Intergenic
919453380 1:197797226-197797248 ATGTTCTTAGGTTCTCCTGAGGG - Intergenic
919596597 1:199571206-199571228 ATGTTCTTAGAATCTCCTGAGGG + Intergenic
919633833 1:199984805-199984827 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
919828509 1:201521362-201521384 ATGTTCTCAAGATCTCCTGAGGG - Intergenic
920520983 1:206626085-206626107 AGATTCTCAGAGTCTCCAGAAGG + Intergenic
921743304 1:218710378-218710400 ACGTTCTTAGGGTCTGCAGAGGG + Intergenic
921863156 1:220060737-220060759 ATGTTCTCAGGACTTCCTGAGGG - Intronic
922025432 1:221744116-221744138 ACGTGCTCAGGACCTCCTGAGGG - Intergenic
922048998 1:221972624-221972646 AGGTTCTCAGGACCTCCTGAGGG + Intergenic
922166267 1:223118048-223118070 ATGTTCTCAGGGTCTCCTGAGGG - Intronic
922202986 1:223422370-223422392 ATGTTCTCAGGACCCCCTGAGGG - Intergenic
922255971 1:223893202-223893224 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
922337481 1:224629396-224629418 ATGTTCTCAGGATCTCCTGAGGG + Intronic
922523127 1:226275189-226275211 AAGTTCACAGGGCCTCCTTAAGG - Intronic
922609764 1:226917238-226917260 ATGTTCTGAGGGTCTCCTGAGGG + Intronic
922694479 1:227721775-227721797 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
922813636 1:228433375-228433397 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
923380770 1:233415762-233415784 GTGTTCTCAGGACCTCCCGAGGG - Intergenic
923707445 1:236355934-236355956 ATGTTCCCAGGACCTCCTGAGGG + Intronic
923755986 1:236791611-236791633 CTGTTCTCAGGACCTCCTGAGGG + Intergenic
923882392 1:238117724-238117746 ATGTTCTCAGGACCTCCTGACGG + Intergenic
924272514 1:242348682-242348704 ATGGTCTCAGGATCTCCTGAGGG - Intronic
924337171 1:242996069-242996091 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
924350458 1:243109371-243109393 ATTTTCTCAGGATCACCTGATGG + Intergenic
924931058 1:248732856-248732878 ATTTTCTCAGGACCTCCTGAGGG + Intronic
1062825056 10:561155-561177 AGGTTCTTAGTATCTCCTGAGGG + Intronic
1062953300 10:1521926-1521948 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1062987136 10:1779626-1779648 ATGTTCTCAATGTCTCCTGAGGG - Intergenic
1063018531 10:2102597-2102619 ATCTTCTCAGGATCTCCTGTGGG - Intergenic
1063107009 10:3001080-3001102 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1063323485 10:5074233-5074255 ATATCCTCAGGACCTCCTGAGGG + Intronic
1063845294 10:10121136-10121158 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1064174370 10:13061520-13061542 ATGTTCTCAGCACCTCCTGAAGG - Intronic
1064542364 10:16417816-16417838 ATGTTCTCAGGGCCTCCTGAGGG + Intergenic
1064570077 10:16683702-16683724 ATGTTCTCAGGACCTCCTGGGGG - Intronic
1064659143 10:17588050-17588072 ATGTTCTCAGGACCTCCTAAGGG + Intergenic
1064938993 10:20712186-20712208 ATGTTCTCAAGATTTCCTGAGGG - Intergenic
1065041023 10:21696332-21696354 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1065131723 10:22628535-22628557 ATGTTCTTAAGATTTCCTGAAGG - Intronic
1065156186 10:22872419-22872441 ATGTTCTCAGGACCTCTTGAGGG + Intergenic
1065365702 10:24934795-24934817 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1065414210 10:25467006-25467028 ATGCTCTCAGGACCTCCTGAGGG - Intronic
1065493836 10:26309051-26309073 ATGTTCTCAGAATCTCCTCAGGG - Intergenic
1065847273 10:29756063-29756085 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1065888560 10:30100787-30100809 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1066040287 10:31542471-31542493 ATGTTCTCAGGGCTTCCTGAGGG + Intergenic
1066062793 10:31738906-31738928 ATGTCCTCAGGATCCCCTGAGGG - Intergenic
1066102693 10:32131999-32132021 ATGTTCTCAGGGCCTCCTGAGGG + Intergenic
1066712153 10:38247460-38247482 ATGGTCTCAGGATCTCCTGAGGG + Intergenic
1067409989 10:46055696-46055718 ATGTTGTCAGAACCTCCTGAGGG - Intergenic
1068177166 10:53476513-53476535 GTATTCTCAGGATCTCCTGAGGG - Intergenic
1068177561 10:53481494-53481516 ATGGTCTCTGGGGCTGCTGATGG - Intergenic
1068181612 10:53527099-53527121 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1068365027 10:56037011-56037033 ATGTTCTCAGGATCTCCTGAAGG - Intergenic
1068366141 10:56052381-56052403 ATGTTTTCAGGACCTCCTGAGGG + Intergenic
1068438450 10:57020183-57020205 AAGTTCTCAGGACCTCCTGAGGG - Intergenic
1068718965 10:60220773-60220795 AGGTTCTCAGGATCTCCTAAGGG + Intronic
1068740225 10:60460510-60460532 GTGTTCTCAGGGTGTTCTGAAGG + Intronic
1069048418 10:63766725-63766747 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
1069119029 10:64545018-64545040 ATGTTCTCAGGGCTTCCTGAGGG + Intergenic
1069170818 10:65226506-65226528 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1069178678 10:65327416-65327438 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
1069180637 10:65354138-65354160 ATGTTCTCAGGATCTCCTAAGGG + Intergenic
1069368185 10:67715440-67715462 CTGCTCTCAAGGTCTCCTGGGGG - Intergenic
1069410838 10:68151922-68151944 ATGTTCTCAGAATCTCCTGAGGG - Intronic
1069543146 10:69310667-69310689 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1069925854 10:71850557-71850579 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1070171906 10:73939307-73939329 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1070255561 10:74810832-74810854 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1070573271 10:77657799-77657821 ATGTTCTGAGGACCTCTTGAGGG - Intergenic
1070581213 10:77721193-77721215 ATGTTGTCAGGACCTCCTGAGGG - Intergenic
1070602043 10:77872866-77872888 ATTTCCCCAGGTTCTCCTGAAGG + Intronic
1070823316 10:79375809-79375831 AAGTTCTCAGGAGCTCCTGGGGG - Intergenic
1070904758 10:80062363-80062385 ACGTTCTCAGGACATCCTGAGGG - Intergenic
1070905427 10:80068250-80068272 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
1070991516 10:80737152-80737174 ATGTTCTCAGGACCACTTGAGGG + Intergenic
1071551738 10:86571277-86571299 ATGTCGTCAGGATCTCCTGAAGG + Intergenic
1071825998 10:89326886-89326908 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1071829112 10:89354376-89354398 ATGTCCTCAGGATCTCCTAAGGG + Intronic
1071926761 10:90417989-90418011 ATGTTCTCAGGCTCTCCTGAGGG + Intergenic
1071981257 10:91006181-91006203 TTGTTCTCAGGGTCACAGGATGG - Intergenic
1072357733 10:94628081-94628103 ATGTTCTTAGGACATCCTGATGG + Intergenic
1072480031 10:95802047-95802069 ATGTTCTCAGGACCTCCCGAGGG - Intronic
1072972074 10:100026028-100026050 ATGTTCTCAGGACCTCCTCCTGG - Intergenic
1073058416 10:100716898-100716920 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1073819870 10:107249443-107249465 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1073867730 10:107824433-107824455 TAGTTCTCAGGACCTCCTGAGGG - Intergenic
1073905709 10:108276956-108276978 CTGTCCTCAGGATCTCCTGCGGG - Intergenic
1073980521 10:109148535-109148557 ATGTTCTTAGGATTTCCTGAGGG - Intergenic
1073995062 10:109306297-109306319 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1074002197 10:109384389-109384411 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1074215124 10:111376719-111376741 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1074419622 10:113297690-113297712 ATGTTCTGAAGGTCTCTTCAGGG - Intergenic
1074840675 10:117347538-117347560 ATGTTCAAAGGACCTCCTGAGGG + Intronic
1074944704 10:118270260-118270282 ATGGGCTCAGGGACTCCTCAGGG - Intergenic
1076007419 10:126958897-126958919 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1076270883 10:129151102-129151124 ATATTCTCAGGATCTCCTGAGGG + Intergenic
1076324677 10:129611965-129611987 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1076653509 10:132006131-132006153 AGGTTCTCAGGACCTCCTGAGGG - Intergenic
1076654757 10:132016605-132016627 AGGTTCTCAGGACCTCCTGAGGG - Intergenic
1076822851 10:132949409-132949431 ATGTTCTCAGGAACTCCTGAAGG - Intergenic
1076838965 10:133035719-133035741 ATGCTCTCAGGACCTCCTGGGGG + Intergenic
1076977394 11:184634-184656 ATGTTCTCAGGGTCTCCTGAGGG + Intronic
1076996838 11:301521-301543 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1076999802 11:316870-316892 ATGTTCTCAAGACCTCCTGAGGG - Intergenic
1077038154 11:505147-505169 ATGTTCCCAGGATCCCCTGAGGG + Intronic
1077078620 11:712735-712757 AAGAGCTCAGGGACTCCTGATGG - Intronic
1077221894 11:1421639-1421661 ATGTTCTGAGCGTGTGCTGAGGG + Intronic
1077529302 11:3087733-3087755 ATGTGGACAGGGTCTCCGGAAGG + Exonic
1077621030 11:3723859-3723881 AAGTTCTCAGGGCCTCCTGAGGG - Intronic
1077714501 11:4568156-4568178 ATGTTCTGAGGACCTCCTGAGGG - Intergenic
1077885696 11:6386148-6386170 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1078074546 11:8146595-8146617 GTGTTCTCAGGACCTCCTGAGGG - Intronic
1078403292 11:11046254-11046276 ATGTTCCCAGGATCTCCTGAGGG - Intergenic
1079163744 11:18017269-18017291 ATGTTCTCAGGGTCTCCTAAGGG + Intergenic
1080072195 11:28102496-28102518 ATGCTCTCAGGACCTCCTGAGGG + Intronic
1080278072 11:30525241-30525263 ATATTCTAAGTGTCTCCTGAGGG - Intronic
1080873287 11:36255735-36255757 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1080950516 11:37026911-37026933 ATGTTCTTAGGGTCTCCTGAGGG + Intergenic
1081098917 11:38977678-38977700 ATGTTCTCAGAACCTCCTGAGGG - Intergenic
1081131304 11:39383483-39383505 ATATTCTCTGGGAGTCCTGAGGG + Intergenic
1081379613 11:42398707-42398729 ATATTCTCAGGACCTCCTGAGGG - Intergenic
1081896075 11:46587759-46587781 GTGTTCTTATGGTCTCCTTATGG - Intronic
1082103289 11:48192246-48192268 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
1082701946 11:56442730-56442752 ATGTTCTCAGGACAGCCTGAGGG - Intergenic
1082704378 11:56475714-56475736 AAGTTCTCAAGTCCTCCTGAGGG + Intergenic
1082737449 11:56872645-56872667 ATGTCTTCAGGGCCTCCTGAGGG + Intergenic
1082846245 11:57728074-57728096 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1082846665 11:57731543-57731565 ATATTCTCAGGACCTCCAGAGGG + Intronic
1083012757 11:59419513-59419535 ATATTCTCAGGACCTTCTGACGG - Intergenic
1083055064 11:59811440-59811462 ATGTTCTCAGGACCCCCTGAGGG - Intergenic
1083096535 11:60256548-60256570 ATGTTCCGAGGATCTCCTGATGG + Intergenic
1083105888 11:60358410-60358432 ATGTTCTCAGGACCTCCTGAAGG - Intronic
1083353033 11:62044690-62044712 ATGTTCTCAGGGTCTCCTGGGGG - Intergenic
1083539269 11:63500913-63500935 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
1083539418 11:63502057-63502079 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
1084217955 11:67661302-67661324 ATGTTCTCAGGATCTCCTAAGGG + Intergenic
1084606604 11:70175986-70176008 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1084801046 11:71544243-71544265 CTGCTCTCAGGACCTCCTGAGGG - Intronic
1084801149 11:71545013-71545035 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1084933101 11:72572400-72572422 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1085281355 11:75333065-75333087 ATGTTCTCAAGACCTCCTGAGGG + Intronic
1085482231 11:76832318-76832340 ATTTGCCCAGGGGCTCCTGATGG - Intergenic
1085765514 11:79278500-79278522 AGGTTCTCAGCGGCTCCTGCTGG - Intronic
1086283043 11:85213256-85213278 ATGTTCTCTGTATCTCCTGAGGG - Intronic
1086416894 11:86597743-86597765 ATGTTGTGAGGATCTCCTGAGGG - Intronic
1086501927 11:87462593-87462615 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1086697069 11:89859909-89859931 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1086709089 11:89984578-89984600 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1086856938 11:91876780-91876802 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1087390226 11:97521737-97521759 ATGCTCTCAGGACCTCCAGAGGG - Intergenic
1087955061 11:104276087-104276109 TTGTTGTCAGTGTCTGCTGAAGG - Intergenic
1088008861 11:104974518-104974540 ATGTTCTCAGGACCTCCTTGAGG - Intergenic
1088087116 11:105994713-105994735 ATGTTCTCAGGACCTCCTGAAGG - Intergenic
1088129334 11:106468041-106468063 ATGTTCTCAGGACCTTCTGAGGG + Intergenic
1088212892 11:107475785-107475807 ATGTTCCTAGGACCTCCTGAGGG + Intergenic
1088313820 11:108487344-108487366 AGGTTCTCAGGATGTCCTGAGGG + Intronic
1088651547 11:111961931-111961953 AGCTTCAGAGGGTCTCCTGAAGG - Intronic
1088877801 11:113950322-113950344 ATGTTCTCAGGGTCTCCTGGGGG + Intergenic
1088948632 11:114541526-114541548 ATGTTCTCAGGACCTCCTGACGG - Intronic
1088966219 11:114724173-114724195 AATTTCTCAGGGTCACCTGAAGG + Intergenic
1089519384 11:119053730-119053752 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1089566149 11:119372810-119372832 ATGATTTCAGGGACTCGTGAGGG + Exonic
1089864110 11:121616820-121616842 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1090096915 11:123751526-123751548 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1090108419 11:123876756-123876778 ATGTTCTCAGGACCTTCTAAGGG + Intergenic
1090877653 11:130805282-130805304 ATGTTCTCAGGATCTCCTGATGG + Intergenic
1091242347 11:134062273-134062295 CTGTTCTCAGGATCTCTTGCGGG + Intergenic
1091257136 11:134198502-134198524 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1091362613 11:134989575-134989597 ATGTTCTCAAGATCTCCTGAGGG + Intergenic
1092304151 12:7282343-7282365 ATGTTCTCAGGCTCTTCTGAGGG + Intergenic
1092305457 12:7296059-7296081 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1092336125 12:7635621-7635643 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1092499525 12:9031641-9031663 ATGTTCCCAGGACCTCCTGAGGG - Intergenic
1092592027 12:9960989-9961011 ATGTTCGCAGGGCCTCCTGAGGG - Intronic
1092645767 12:10570294-10570316 ATGTTCTCAGGTTCTCCTGAGGG + Intergenic
1093188766 12:16051294-16051316 AGGTTCTTAGGGGCTCCTAAGGG - Intergenic
1093683688 12:22031636-22031658 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1093753457 12:22827515-22827537 ACGTTCTCAGGAACTCCTGAGGG + Intergenic
1093762392 12:22924882-22924904 ATGTTCTCAGCATCTCCTGGGGG + Intergenic
1094018416 12:25887833-25887855 ATGCTCTCAGGACCTCTTGAGGG + Intergenic
1094133584 12:27100680-27100702 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1094183735 12:27618727-27618749 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1094384977 12:29884552-29884574 ATGTTCTTATGATCTCCTGAGGG - Intergenic
1094459153 12:30675018-30675040 ATCATCTCAGAGTGTCCTGAAGG - Intronic
1094588641 12:31800828-31800850 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1094589470 12:31806964-31806986 ACATTCTCAGGATCTCCTGAGGG + Intergenic
1094589712 12:31808971-31808993 ATATTCTCAGAATCTCCTGAGGG + Intergenic
1094618451 12:32057405-32057427 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
1094618689 12:32059581-32059603 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
1094644681 12:32311106-32311128 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1094719839 12:33052565-33052587 GTGGGCTCAGGGTCTCCTGCCGG + Intergenic
1095215344 12:39540919-39540941 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
1095314633 12:40745289-40745311 ATGTTCTCAGCATCTCCTGAGGG - Intronic
1095896412 12:47284351-47284373 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1095999346 12:48115696-48115718 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1095999552 12:48117764-48117786 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1096034074 12:48448840-48448862 ATGTTCTCAGGATCCCCTGAGGG - Intergenic
1096049360 12:48593633-48593655 ATGTTCTCAGGACCCCCTGAGGG + Intergenic
1096353889 12:50923914-50923936 ATGTTCTCAGGATTTCCCGAGGG - Exonic
1097354576 12:58586932-58586954 ATTTTCTCAGCGTCTGGTGAGGG - Intronic
1097595907 12:61630658-61630680 ATGTTCTCAGAACCTCCTGAGGG - Intergenic
1097669761 12:62521507-62521529 ATGGTCTCAGGGACTCCTAAGGG + Intronic
1098310118 12:69140168-69140190 ATGTTCTCAGGACATCCTGAGGG + Intergenic
1098316161 12:69195519-69195541 ATGTTCTCAGGAGCTCTCGAGGG - Intergenic
1098638649 12:72814570-72814592 ATGTTCTCAGGACTTCCTGAGGG - Intergenic
1098674671 12:73273964-73273986 ATGTTCTCAGGATCTCCTAAGGG - Intergenic
1098831075 12:75363776-75363798 ATGTTCTCAGGGTCTCCTGAGGG - Intronic
1098948148 12:76610386-76610408 ATGATCTCAGGATCTTCTGAGGG + Intergenic
1099094397 12:78355626-78355648 ATGATCTCAGAACCTCCTGAGGG - Intergenic
1099246318 12:80197287-80197309 CTGTTCTCAGGGTCTCCTGAGGG + Intergenic
1099761151 12:86922001-86922023 ATATTCTCAGGACCTCCGGAGGG - Intergenic
1100362454 12:93891136-93891158 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1101678216 12:106939159-106939181 ATGTTTTCAAGACCTCCTGAGGG - Intergenic
1101679134 12:106947743-106947765 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1101963477 12:109266429-109266451 AAGTCTTCAGGGTCTGCTGAGGG - Exonic
1102415992 12:112763342-112763364 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1102462392 12:113107982-113108004 ATGTTCTTTGGGTCTTCTGTGGG + Intronic
1103095926 12:118132393-118132415 ATTTTCCCTGGGTCTCCTGAGGG - Intronic
1104204115 12:126620003-126620025 ATGTTCTCAGGCCCTCCTGAGGG - Intergenic
1104383320 12:128327311-128327333 ACGTTCTCAGGATCTCCTGTGGG - Intronic
1104449695 12:128859101-128859123 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1104671595 12:130684361-130684383 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1104781866 12:131426855-131426877 ATTTTCTCAGGATCTCCTGAGGG + Intergenic
1105236333 13:18557146-18557168 ATTTTCTTAGGGTTGCCTGATGG + Intergenic
1105316110 13:19265278-19265300 ATGTTCTCAGAATCTCCTGAGGG + Intergenic
1105376111 13:19846515-19846537 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1105812784 13:24009413-24009435 ATGTTCTCAGGATCTCCTAATGG - Intronic
1106119827 13:26850962-26850984 GTGTTCTCAGGACTTCCTGAGGG + Intergenic
1106207822 13:27616023-27616045 ATGTTCTTAGGACCTCCTGAAGG - Intronic
1107073681 13:36298494-36298516 GTGTTCTCAGAATCTCCTGAGGG - Intergenic
1107079248 13:36356716-36356738 ATGTTCTCAGGACCTCCTGAAGG + Intronic
1107362931 13:39639397-39639419 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1107530799 13:41280472-41280494 AGGTTCTCAGGACCTCCTGAGGG + Intergenic
1107530822 13:41280679-41280701 ATGTTCTTAGGATCTCCTGAGGG + Intergenic
1107943401 13:45395018-45395040 ATGTTCTCATGGGCTTCTCATGG - Exonic
1107952551 13:45477259-45477281 GTGTTCTCAGGTTCACTTGAAGG + Intronic
1108047015 13:46392700-46392722 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1108200131 13:48035013-48035035 ATGTTGTCAGGGTCTCCCAAGGG - Intergenic
1108258060 13:48629619-48629641 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1108279982 13:48851622-48851644 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1108299084 13:49055817-49055839 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1108315934 13:49237655-49237677 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1108323231 13:49306229-49306251 ATGTCCTCAGGGTCGGCAGAGGG + Intergenic
1108417398 13:50212109-50212131 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1108463917 13:50695411-50695433 ATGTTCTTAGGACCTCCTGAGGG - Intronic
1108554816 13:51582678-51582700 ATGTTCTCAGGACCTCCTAAGGG - Intergenic
1108613748 13:52109931-52109953 ATGTTCTTAGGATCTCCTGAGGG + Intronic
1108900515 13:55400525-55400547 ATGGTCTCAGAACCTCCTGAGGG - Intergenic
1109157467 13:58928635-58928657 AAGTTCTCAAGATCTCCTGAAGG - Intergenic
1109246935 13:59966403-59966425 CTTTTCTCCTGGTCTCCTGATGG - Intronic
1109380970 13:61558892-61558914 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1109443787 13:62407044-62407066 ATGTTCTCAAGCTCTCCTGAGGG - Intergenic
1109570261 13:64179428-64179450 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1109963483 13:69661306-69661328 AGGTTCTCAGGACCTCCTGAGGG + Intergenic
1109967821 13:69724304-69724326 ATGTCGTCAGGACCTCCTGAGGG + Intronic
1110058844 13:71015408-71015430 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1110815945 13:79860118-79860140 ATGTTCTTAGGGCCACCTGTGGG - Intergenic
1111055678 13:82946797-82946819 ATGTTCTCAGGATCTCCTGTGGG - Intergenic
1111122498 13:83871908-83871930 ATGTTCTCAGGACCCCCTGAGGG + Intergenic
1111517350 13:89351792-89351814 ACATTCTCAGAGTCTCCTGAGGG + Intergenic
1111731041 13:92077212-92077234 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1112079600 13:95954788-95954810 ATGTTCTCAGGATCTCCTAAGGG + Intronic
1112261395 13:97881244-97881266 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1112280822 13:98061479-98061501 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1112281333 13:98065390-98065412 GTGTTCTCAGGATCTCCTGAGGG - Intergenic
1112366132 13:98756963-98756985 ATGTTCTCAGGATCTCCCAAGGG + Intergenic
1112619458 13:101039846-101039868 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
1112868769 13:103942326-103942348 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1113161966 13:107391884-107391906 ATGTTCTCTGGACCTCCTGAGGG + Intronic
1113262870 13:108585180-108585202 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1113609346 13:111632260-111632282 ATGTTCTCAGGATCCCCTGAGGG - Intronic
1113740538 13:112709787-112709809 ATGTTCTCAGGACATCCTGAGGG + Intronic
1113886735 13:113664999-113665021 ACGTCCCCACGGTCTCCTGAGGG - Intergenic
1113926236 13:113943218-113943240 ATGTCCTCAGGCCCTCCTGAGGG - Intergenic
1114080173 14:19196969-19196991 ATGTTCTCAGGGTCTTCTGAGGG - Intergenic
1114237770 14:20837152-20837174 ATGTTCTCAGGATCTCTTGAGGG - Intergenic
1114387468 14:22269915-22269937 ATGTTCTCGGAACCTCCTGAGGG - Intergenic
1115303397 14:31910273-31910295 ATGTTTTCAGGATCTCCTGAGGG - Intergenic
1115352538 14:32410522-32410544 ATGTTCTCAGGTCCTCCGGAGGG + Intronic
1115476716 14:33821460-33821482 ATGTTCTCAGGGGCTCCTGAGGG + Intergenic
1115532609 14:34341246-34341268 ATGTTCTTGGGATCTCCTGAGGG - Intronic
1115616058 14:35095920-35095942 CTATTCCCAGGGTCTACTGATGG - Intronic
1115617819 14:35113051-35113073 ATGTTCTCAGGATCTCTTGAAGG + Intronic
1116309954 14:43312169-43312191 ATGTTCTCAGAATCTCCTGATGG + Intergenic
1116471902 14:45295307-45295329 ATGTTCTCAGGCCCTCCTGAAGG + Intergenic
1117019296 14:51552908-51552930 AGGTTCTCAGTGGCTCCTGCAGG + Intronic
1117209633 14:53482090-53482112 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1117444097 14:55787346-55787368 ATGTTCTCAGGATCTCTTGAGGG - Intergenic
1117861980 14:60101283-60101305 ATGTTCTGAGGACCTCCTGAGGG + Intronic
1117891797 14:60430185-60430207 ATGTTCTGAGGATCTCCTGAGGG - Intronic
1117926898 14:60790637-60790659 ATGTCATCAGGACCTCCTGAGGG + Intronic
1118367306 14:65106899-65106921 ATGTTCTCAGGATCTCTTGAGGG - Intergenic
1118369304 14:65123663-65123685 ATGTTCCCAGGATCTCCTTAGGG - Intergenic
1118576148 14:67243004-67243026 GTGTTTTCAGGATCTCCTGAGGG + Intronic
1118600759 14:67470206-67470228 ACTTTCTCAGGGGCTCCTGGAGG - Intronic
1118604458 14:67492520-67492542 ATGTCCTTAGGGTGTCCTGGAGG + Intronic
1119591734 14:75895121-75895143 ATGTTCTCAGGACTTCCTGAGGG + Intronic
1120425100 14:84337516-84337538 ATGTTCCCAGGACCTCCTGAGGG + Intergenic
1120466311 14:84862057-84862079 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1120690071 14:87582354-87582376 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1120694863 14:87633320-87633342 ATGTCCTCAGGACCTTCTGAGGG - Intergenic
1120771319 14:88383553-88383575 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1120974811 14:90239242-90239264 ATGTTCTCAGAATCTCCTGAGGG + Intergenic
1121163012 14:91762662-91762684 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1121268479 14:92621387-92621409 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1121663441 14:95653297-95653319 TAGTTCTCAGGATCTCCTGAGGG + Intergenic
1121731524 14:96190587-96190609 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1122186343 14:100000150-100000172 ACGTTGTCAGGACCTCCTGAGGG - Intronic
1122270313 14:100566049-100566071 GTGTTCTCAGAGTTGCCTGAAGG - Intronic
1122653830 14:103243470-103243492 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1122709251 14:103643533-103643555 ATGTTCTCAGGACTTCCTGAGGG - Intronic
1122832618 14:104407908-104407930 ATGTTCTTAGGACCTCCTGAGGG - Intergenic
1122950262 14:105040576-105040598 ATGTTCTCAGGACCTCCTGACGG - Intergenic
1123669746 15:22643853-22643875 GTGTTCTCAGGATCTCCTTAGGG + Intergenic
1123876551 15:24629337-24629359 ATGTTCTCAGGACTTCCTGAGGG + Intergenic
1123955069 15:25326615-25326637 ATCTTCTTAGGGTCGACTGATGG - Intergenic
1124033133 15:26029510-26029532 ATGTTCCCAGGACCTCCTGAGGG - Intergenic
1124201831 15:27685174-27685196 GTGTTCTCAACATCTCCTGAGGG + Intergenic
1124525719 15:30450269-30450291 GTGTTCTCAGGATCTCCTTAGGG + Intergenic
1124664060 15:31576627-31576649 ATGCACTCAGGATCTCCTGAGGG + Intronic
1124772936 15:32557416-32557438 GTGTTCTCAGGATCTCCTTAGGG - Intergenic
1125332057 15:38592054-38592076 ATGTTCTCAGGATCTTCTGAGGG + Intergenic
1126118019 15:45226564-45226586 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1126124786 15:45285376-45285398 GTGTTCTTAGGACCTCCTGAGGG + Intergenic
1126145573 15:45470239-45470261 CTGTTCTCAGAATTTCCTGAAGG - Intergenic
1126266910 15:46765890-46765912 ATGCTCTCAGGACCTCCTAAAGG - Intergenic
1126267680 15:46773727-46773749 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1126644950 15:50866759-50866781 ATGTTCCCAGGACCTCCTGAGGG - Intergenic
1126645924 15:50874790-50874812 ATGTTCTCAGGACCTCCTAAGGG - Intergenic
1126662387 15:51045678-51045700 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1126946079 15:53821973-53821995 ATGTTCTCAGGATCGCCTGAGGG + Intergenic
1127305837 15:57705150-57705172 GTGTTCTCAGGATCTCCTGAGGG + Intronic
1127370116 15:58331352-58331374 ATGCTCTGTGGGTCTCCTGAAGG - Intronic
1127507290 15:59609649-59609671 ATGTTCTCTGGACCTCCTGAGGG + Intronic
1127575244 15:60285629-60285651 ATGTTCTAAGGATCTCCAGAGGG - Intergenic
1128312779 15:66641889-66641911 TTGTTCTCAGGGCCTCCTGCAGG + Intronic
1128469568 15:67940859-67940881 ATGTTCTCAGGACCTCTTGAGGG + Intergenic
1128539149 15:68512868-68512890 TTTTTCTCAGAGTCTCCAGAAGG + Intergenic
1128601542 15:68999298-68999320 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1128603577 15:69017663-69017685 ATGTTCTCAGGATAGCTTGAGGG + Intronic
1128705478 15:69834869-69834891 ATGTGCTCAAGGTCTCCTGAAGG - Intergenic
1129195556 15:73963660-73963682 ATGTTCTCAGGAGCTTCGGAGGG + Intergenic
1129387952 15:75206337-75206359 ATCTTCTCAGGGCCTTCTGCTGG - Exonic
1130074505 15:80677016-80677038 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1130861642 15:87896102-87896124 ATGTTCTCAGGACCTCATGAGGG + Intronic
1130889733 15:88123584-88123606 ATGTTCTAAGGATCTCCTGAGGG - Intronic
1131008393 15:88997263-88997285 ATGTTCTCAGGGCTTCCTGAGGG + Intergenic
1131193235 15:90334111-90334133 ATGTTCTCAGGACCTCCCGAGGG - Intergenic
1131464890 15:92646957-92646979 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1131636489 15:94238097-94238119 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1131871728 15:96770863-96770885 ATGTTCTTAGGACCTCCTGAGGG + Intergenic
1132485742 16:189894-189916 GTGTTCCCAGGGTCTGCTGAGGG - Intronic
1132551017 16:553826-553848 GTGGGCTCAGGGTCTCCTGCGGG + Exonic
1132790688 16:1685542-1685564 ATGTTCTGAGGTTCTTCTGTTGG - Exonic
1133398788 16:5469627-5469649 ATGGTCGCAGGGTCTCCTTTGGG - Intergenic
1133645915 16:7764381-7764403 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1133800029 16:9077817-9077839 ATGTTCTCATGACCTCCTAAGGG - Intergenic
1133881592 16:9787539-9787561 TTGTTCTCAGGACCTCCTGGGGG + Intronic
1133949590 16:10379867-10379889 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1134001899 16:10789436-10789458 ATGTTCTCAGGATCTCCTGAAGG - Intronic
1134171217 16:11971288-11971310 GTGTTCTCAGAATCTCCTGAGGG - Intronic
1134338618 16:13324743-13324765 ATGTTCTCAGAACCTCCTGAGGG - Intergenic
1134368187 16:13598712-13598734 AGGTTCTCAGGATCTCCTGAGGG - Intergenic
1134592592 16:15467746-15467768 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1134593564 16:15476737-15476759 ATGTCATCAGGGTCTGGTGATGG - Intronic
1134866422 16:17611240-17611262 ATGTTCTTGGGATCACCTGAGGG + Intergenic
1135023062 16:18978697-18978719 ATGTTCTCAAGACCTCCTGAGGG - Intergenic
1135204767 16:20474145-20474167 GTGTTCTCAGGACATCCTGAGGG + Intronic
1135214125 16:20549668-20549690 GTGTTCTCAGGACCTCCTGAGGG - Intronic
1135225194 16:20649840-20649862 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1135226161 16:20660050-20660072 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1135229471 16:20692229-20692251 ATAGTCTCAGGATTTCCTGAGGG - Intronic
1135256618 16:20946459-20946481 ATGCTCTCAGGATCTCCTGAGGG + Intronic
1135776206 16:25258880-25258902 ATGTTCTCAGGGCCTCGAGAGGG - Intergenic
1135777969 16:25273605-25273627 ATGTTCTCAGGGTTTCCTGAGGG - Intergenic
1135811285 16:25588868-25588890 ATATTCTCAGAATCTCCTGAGGG + Intergenic
1138065542 16:53937467-53937489 AGGTTCTTAGGGTCTACTGTAGG + Intronic
1138296758 16:55892394-55892416 ATGTTCTCTTGACCTCCTGAGGG + Intronic
1138932571 16:61678271-61678293 ATGTTCTCAGAATCTCCTGAGGG + Intronic
1138995409 16:62445691-62445713 ATGTTGTCAGGACCTCCTGAGGG + Intergenic
1140054295 16:71512019-71512041 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1140056124 16:71527355-71527377 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1140427726 16:74874961-74874983 ATTTTCTCAGGGGCTCCGCATGG + Intronic
1140747288 16:77992228-77992250 AAGTTCTCAGGACCTCCTGACGG - Intergenic
1140916799 16:79501123-79501145 AGTTTCTCAGGGTCTCCAGAGGG - Intergenic
1141030623 16:80584603-80584625 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1141170991 16:81691593-81691615 ATGTTCTCAGCGTGGCCTCAAGG - Intronic
1141371859 16:83495149-83495171 ATGTTCTCAGGGTCTCCTGAGGG - Intronic
1141781060 16:86161670-86161692 ACATTCTCAGGACCTCCTGAGGG - Intergenic
1142442856 16:90112050-90112072 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
1142464845 17:129341-129363 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1143017297 17:3897819-3897841 ATGTCCTCATGTTCTCCTGCAGG + Exonic
1143156425 17:4840063-4840085 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1143413831 17:6730182-6730204 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
1143420495 17:6787844-6787866 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1143657586 17:8305236-8305258 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1143803687 17:9407529-9407551 ATGTTCCCAGGATCTCCTGAGGG - Intronic
1143986394 17:10918240-10918262 ATGTTCTTAGGATCTCCTGAGGG + Intergenic
1144189741 17:12833639-12833661 ACATTCTCAGGATCTCCTGAGGG - Intronic
1144570875 17:16398019-16398041 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1144637848 17:16922136-16922158 ATGTTCTCACGATCTCCTGAGGG + Intergenic
1145024733 17:19459567-19459589 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1145293291 17:21567344-21567366 ATGTTCTCAGGGTCTCCTGAGGG - Intronic
1145362990 17:22227629-22227651 CTGCTCTCAGGATCTCCTGAGGG + Intergenic
1145386678 17:22418593-22418615 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1145887124 17:28390021-28390043 GTGTTCTCAGGGTCTCCTGAGGG - Intronic
1146005367 17:29157295-29157317 TTGCTCTCAGTGTCTCCTGAGGG - Intronic
1146130993 17:30275003-30275025 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1146238611 17:31192258-31192280 ATGTTCTCAGGAACTCCTGATGG - Intronic
1146513136 17:33467876-33467898 ATGTTCTCAGGATCCCCTGAGGG + Intronic
1146602302 17:34228345-34228367 ATGTTCTCAGGGTCTTCTAAGGG + Intergenic
1146811203 17:35905095-35905117 ATGTTCTCAGGACTTCCTGAGGG - Intergenic
1146937988 17:36824376-36824398 CTGTTCTCAGGGTCTCTTTAAGG - Intergenic
1146956988 17:36941630-36941652 AGGTTCTCACAGTCTCCTGTAGG - Intronic
1147188733 17:38726657-38726679 ATGGTCTCAGGGCCCCCTTAGGG + Exonic
1147279600 17:39348126-39348148 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1147379987 17:40048918-40048940 ATGTTTTCAGGACCTCCTGAAGG - Intronic
1147920967 17:43916886-43916908 ATGTTCTCAGGATCTGCTGAAGG + Intergenic
1148983561 17:51600470-51600492 ATGTTTTCAAGATCTCCTGAGGG + Intergenic
1149136124 17:53366626-53366648 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1149170425 17:53803604-53803626 ATGTTCTCAGGACATCCTGAGGG - Intergenic
1149217494 17:54374955-54374977 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1149297797 17:55276337-55276359 ATGTTCTCAGTGTCAAATGACGG + Intronic
1149763915 17:59259006-59259028 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1150659832 17:67065626-67065648 CTGTTCTCAGGACCTCCTGAGGG + Intergenic
1150909114 17:69369937-69369959 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1150917810 17:69454316-69454338 ATGTTCTCACTGTGTCCGGAGGG + Intronic
1150956179 17:69862780-69862802 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1151132905 17:71916611-71916633 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1151217605 17:72588324-72588346 CTGTCCTCAGCGTCTCCTGGTGG - Intergenic
1151914865 17:77110485-77110507 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1152045913 17:77935609-77935631 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1152319319 17:79599296-79599318 AGATTCTCAGGGTCCCTTGAAGG + Intergenic
1152432738 17:80258562-80258584 ATGTTCTCAGGGCCTCCTGAGGG - Intergenic
1152824019 17:82452619-82452641 GTGTTCTTAGGATCTCCTAAGGG + Intergenic
1152969058 18:143647-143669 ATGTCGTCAGGACCTCCTGAGGG + Intergenic
1153023821 18:656404-656426 ATGTTCTCAGGATCTGCTGAGGG + Intronic
1153043000 18:831657-831679 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1153136160 18:1919991-1920013 ATGTTCTTAGGACCTCCTGAGGG - Intergenic
1153138253 18:1942149-1942171 ATATTCTCAGGAACTCCTGAGGG - Intergenic
1153415910 18:4845367-4845389 ATGTTCTTAGGACCTCCTGTGGG + Intergenic
1153552522 18:6276274-6276296 ATGTCATCAGGACCTCCTGAGGG + Intronic
1153832969 18:8939402-8939424 ATATTCTCAGGATCTCCTGAGGG - Intergenic
1153868153 18:9292106-9292128 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1154089209 18:11341977-11341999 ATGTTCTCGGGACCTCCTGAGGG - Intergenic
1154151122 18:11907439-11907461 GCGTTCTCAGGGTCTCCAAATGG + Intronic
1154373975 18:13793604-13793626 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1154375506 18:13806084-13806106 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1154489218 18:14906768-14906790 ACGTTCTCAAGATCTCCTGAGGG - Intergenic
1154513205 18:15132854-15132876 ATTTTCTTAGGGTTGCCTGATGG - Intergenic
1155955359 18:31952314-31952336 ATGCTCTCAGGACTTCCTGAGGG + Intronic
1156311160 18:35923352-35923374 ATGTTCTCAGGACCTCCTAAGGG - Intergenic
1157149693 18:45204238-45204260 ATGTCCTCTTGTTCTCCTGACGG - Intergenic
1157671821 18:49536768-49536790 ATGTTCTCGGGATCTCCTAAGGG - Intergenic
1157721142 18:49925441-49925463 ATGTTCTAAGGATCTCCTGAGGG + Intronic
1157909736 18:51604495-51604517 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1158084612 18:53635945-53635967 ATGTTCTCAGGACATCCTGAGGG + Intergenic
1158170978 18:54599154-54599176 ATGTTCTCAGGACCTCCTGAGGG + Exonic
1158664014 18:59416144-59416166 ATGTTCTCAGAATCTCCTTAGGG - Intergenic
1158871410 18:61692081-61692103 ATGTTCTCAGGACCTCTTGAGGG - Intergenic
1158894143 18:61897488-61897510 ATGTTCTCGGGACCTCCTGAGGG - Intergenic
1159013080 18:63077063-63077085 ATGTTGTAAAGTTCTCCTGATGG + Intergenic
1159280208 18:66274966-66274988 ATGTTCTCAGGATCTCCAGAGGG + Intergenic
1159324219 18:66894002-66894024 ATGTTCTGAGGCTCTCCTGAGGG - Intergenic
1159584037 18:70265786-70265808 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1159594311 18:70368047-70368069 ATGTTCTCAGGACCTCGTGAGGG + Intergenic
1159653481 18:71004572-71004594 ACATTCTCAGGATCTCCTGAGGG - Intergenic
1159786341 18:72718794-72718816 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1159937892 18:74383098-74383120 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1160315409 18:77839989-77840011 AAGTTCTGATGGTCTTCTGAAGG + Intergenic
1160537293 18:79601631-79601653 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1160852489 19:1199652-1199674 CTATTCTAAGGGTCTCCTGCAGG - Intronic
1161168826 19:2802910-2802932 TTGTTCGGAGGGACTCCTGAGGG - Intronic
1161169799 19:2807093-2807115 AGGTTCTCAGGGTCACCCCAGGG + Intronic
1161738091 19:6004052-6004074 GTGTGCTCAGGGCTTCCTGAAGG + Intronic
1161895420 19:7075923-7075945 ATGTACTCAGGGACTCTGGAGGG - Intronic
1162273315 19:9633743-9633765 ATGCTATCGGGGTCCCCTGAGGG + Exonic
1162294423 19:9803291-9803313 ATGTTCTCCTGGCCTCCTGAGGG + Intergenic
1162294575 19:9804387-9804409 ATGTTCTCAGGACATCCTGAGGG - Intergenic
1162482647 19:10937478-10937500 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1162803652 19:13124957-13124979 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1162829513 19:13275750-13275772 ATGTTCTCAGGGTCTAGGGATGG - Intronic
1163061060 19:14762094-14762116 ATGTTCTCAGGGGCTCCTGAGGG + Intronic
1163097794 19:15072901-15072923 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1164227050 19:23255113-23255135 ATGTCCTCAGGACCTTCTGAGGG - Intergenic
1164613569 19:29650477-29650499 ATGTTCTCAAGACCTCCTGAGGG - Intergenic
1164687434 19:30176897-30176919 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1165002079 19:32772453-32772475 ATGTTGCCATGGTCTTCTGAGGG + Intronic
1165379918 19:35471770-35471792 ATGTTCTCAGGACCTCCTGGGGG + Intergenic
1165549822 19:36574110-36574132 AGGTTCTCAAGATCTCCTGAGGG - Intronic
1165916382 19:39263573-39263595 TGGTTCTCAGGATCTCCTGGGGG + Intergenic
1166402612 19:42494673-42494695 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1166418321 19:42612408-42612430 AGGTTCTCAGGACCTACTGAGGG + Intronic
1166512549 19:43419245-43419267 ACGTTTTCAGGGTCTCCTGAGGG - Intergenic
1166585010 19:43937896-43937918 ATGTTCTCAGGGTCTTCTGAGGG + Intergenic
1166655028 19:44604872-44604894 ATGTTTTCAGGGTCACCTGAGGG + Intergenic
1166859552 19:45801945-45801967 ATGTTCCCAGAACCTCCTGATGG + Intronic
1167756796 19:51417780-51417802 TTGTCCTCTGGGTCTCCTGGGGG + Intronic
1167769872 19:51508490-51508512 TTGTCCTCTGGGTCTCCTGGGGG - Intergenic
1167943189 19:52963775-52963797 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1168084438 19:54035015-54035037 ATGGTCTCAGGACCTCCTTAGGG - Intergenic
1168114877 19:54216953-54216975 AAGTTCCCAGCGTCTCCTCATGG + Exonic
1168455004 19:56500008-56500030 ATGTTCTCAAGACTTCCTGAGGG + Intergenic
1168498232 19:56871997-56872019 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1168622736 19:57892144-57892166 ATGTTCTCAGGACCTCTTGAGGG + Intronic
924979231 2:205576-205598 AAGTTCTCAGGATCTCCTGTGGG + Intergenic
925124933 2:1447507-1447529 AAGTTCTCAGGATCTCCTGAGGG + Intronic
925176419 2:1787338-1787360 ATGTTCTCAGCACCTCCTGAGGG + Intergenic
925229468 2:2220178-2220200 ATGTTCTCAGGACCCTCTGAGGG - Intronic
925357641 2:3253370-3253392 ATGTTCCCAGGACCCCCTGAGGG + Intronic
925800201 2:7591614-7591636 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
925869225 2:8254722-8254744 TTGTTCTCAGGGCCTCCTGAGGG + Intergenic
926412992 2:12624510-12624532 ATGTCCTCAGGATCTCCTGAGGG - Intergenic
926919681 2:17927999-17928021 ATGTTCTCAGGATATGCTGAGGG + Intronic
926999280 2:18775427-18775449 ATGTTCTCAGGATCACATGAGGG + Intergenic
927125559 2:20009988-20010010 ATGTACTCAGGACCTCTTGAGGG + Intronic
927589214 2:24338443-24338465 ATGTTCTCAGGACCTCCTGAAGG + Intronic
927718964 2:25371015-25371037 ATGTTCTCAGGACCTCCTAAGGG + Intergenic
927724481 2:25410851-25410873 GTGTTCTCAGGATCTCCTGAGGG - Intronic
927748782 2:25646808-25646830 ATGTTCTCAGGACCTCCTGAGGG + Intronic
927892827 2:26763149-26763171 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
927950395 2:27164385-27164407 ATATTCTGAGGATCTTCTGAGGG - Intergenic
928350454 2:30548288-30548310 ATGTTCTCAGGACTTCTTGAGGG - Intronic
928510767 2:32000814-32000836 ATGTTCTCAGGACCTCTTGAGGG - Intronic
928566628 2:32558784-32558806 ATGTTTTCAGTATATCCTGAAGG + Intronic
928682099 2:33713118-33713140 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
928682135 2:33713628-33713650 ATGTCCTCAGGACCTCCTGAGGG - Intergenic
928930158 2:36616113-36616135 ATGTTCTCAGGGTCTCCTGAGGG - Intronic
928931528 2:36629838-36629860 ATGTTCTCAGGATCTCCTGAGGG + Intronic
929009579 2:37427745-37427767 ATATGTTCTGGGTCTCCTGAGGG + Intergenic
929657591 2:43749446-43749468 ATGTTCTCAGGACCTCCTGAGGG + Intronic
930150083 2:48050515-48050537 GTGTTCTCAGGATCTCCTGAGGG - Intergenic
930164227 2:48187951-48187973 GTGTTCTCAGGATCTCCTGAGGG + Intergenic
930206643 2:48593593-48593615 ATGTTCTCAGGACCTCCTGAGGG - Intronic
930499413 2:52193169-52193191 ATGTTCTCAGGACCTCCTAAGGG + Intergenic
930538445 2:52673362-52673384 ATATTGTCAATGTCTCCTGAGGG + Intergenic
931257038 2:60582796-60582818 ATGTACTCAGGGTCCCCAGAAGG - Intergenic
931317002 2:61142393-61142415 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
931416742 2:62088798-62088820 ATGTTCTCAGGACCTCCTGAAGG - Intronic
931418105 2:62100404-62100426 ATGTTCTCAGGACCTCCCGAGGG - Intronic
931446337 2:62330358-62330380 ATGTTCTCAGGCCCTCCTGAGGG - Intergenic
931541428 2:63333775-63333797 ATGTCCTCAGGACCTCCGGAGGG + Intronic
931635056 2:64333294-64333316 ATGTTCTCAGGCCCTCCTGAGGG - Intergenic
932058584 2:68471873-68471895 ATGCTCTCAGGACCTCCTGAGGG - Intronic
932078464 2:68689089-68689111 ATATTCTCAGCATCTCCTGAGGG - Intronic
932762956 2:74451553-74451575 ATGTTCTCAGGATCTCTTGAGGG + Intergenic
932873857 2:75430657-75430679 GTGTTCTCAGGACTTCCTGAGGG - Intergenic
933059149 2:77713846-77713868 ATGTTCTCAGGGTCTCTGAAGGG + Intergenic
933066407 2:77804560-77804582 ATGCTCTCAGGAACTCCTGAGGG - Intergenic
933066835 2:77808246-77808268 ATGTCCTCAGGACCTCCTAAGGG + Intergenic
933228670 2:79780271-79780293 ATGTTCTCAGCATCTCCTGAGGG + Intronic
933445188 2:82371060-82371082 ATGTTTTCAGGACCTCCTGAGGG - Intergenic
933514506 2:83283650-83283672 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
933535368 2:83566270-83566292 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
933767199 2:85718297-85718319 ATGTTCTGAGGGTTGTCTGATGG + Intergenic
933939034 2:87230330-87230352 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
934155740 2:89198363-89198385 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
934211581 2:89984396-89984418 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
934626331 2:95858174-95858196 ATGTTCTCAGGACCTCCTGAGGG + Intronic
934667191 2:96180453-96180475 ATGTTCTCAAGATCTCCTGAGGG + Intergenic
934807230 2:97243142-97243164 ATGTTCTCAGGACCTCCTGAGGG - Intronic
934830277 2:97514045-97514067 ATGTTCTCAGGACCTCCTGAGGG + Intronic
934918160 2:98317784-98317806 ATGTCCTCAGGATCTCCTGAGGG + Intergenic
935068820 2:99676020-99676042 CTGCTCTAAGGGGCTCCTGAGGG + Intronic
935241959 2:101186605-101186627 ATATCCTCAGGATCTCCTGAGGG - Intronic
935364562 2:102275671-102275693 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
935625272 2:105167287-105167309 AGATTCTCAGGGGCTCATGAGGG - Intergenic
935721999 2:105987796-105987818 AAGTTCTCAGGACCTCCTTAGGG - Intergenic
935889586 2:107661972-107661994 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
936007116 2:108899341-108899363 ATATTCTCATGCTTTCCTGAAGG - Intronic
936354099 2:111735445-111735467 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
936647901 2:114393047-114393069 ATGTTCTCAGGACTTCCTGAAGG - Intergenic
936871163 2:117135363-117135385 ATGTTCTCAGGACTTCCTGAGGG - Intergenic
936886182 2:117311791-117311813 ATATTCTCAGGACCTCCTGAGGG + Intergenic
937523323 2:122737424-122737446 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
937551137 2:123094182-123094204 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
937577562 2:123442500-123442522 GTGTTCTCAGGATCTCCCGGGGG + Intergenic
937595128 2:123662982-123663004 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
937644379 2:124249698-124249720 ATGTTCTCAGGACCTCTGGAGGG + Intronic
937696361 2:124812837-124812859 ATGTTCTCAGGGTCTCCTGAGGG + Intronic
937775355 2:125769499-125769521 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
937951517 2:127391512-127391534 ATGTTCTCATGATCTCCTGAGGG - Intergenic
938060571 2:128251383-128251405 ATGCTCTCAGGACCTCCTGAGGG - Intronic
938250831 2:129814330-129814352 ATGTTCTCAGGACCCCCTGAGGG - Intergenic
938513453 2:131977469-131977491 ATTTTCTTAGGGTTGCCTGATGG - Intergenic
938739895 2:134221160-134221182 ATGTTCTCAGGACCTCCCGAGGG - Intronic
938875408 2:135527101-135527123 ATGTTCTCAGGACCTCCCGAGGG + Intronic
938966411 2:136392629-136392651 ATGTTCTTGGAGTCCCCTGAGGG - Intergenic
939061767 2:137431078-137431100 ATGTTCTCAGAATCTCCTGAGGG - Intronic
940143961 2:150525544-150525566 ATGTTCTCAGGACCTCCTGAGGG - Intronic
940209887 2:151245487-151245509 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
940564494 2:155343555-155343577 ATGTTCTCAGAATCTCCTGAGGG + Intergenic
940973761 2:159921588-159921610 ATGTCATCAGGCTCTCCTGAAGG + Intergenic
942172608 2:173302646-173302668 ATGTTCTCAGGACCTCCTGGGGG - Intergenic
942174436 2:173318462-173318484 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
942543801 2:177041741-177041763 ATGTTCTCAGGATCTCTTGAGGG + Intergenic
943483121 2:188446957-188446979 ATGTTCTCAGGGTCTCCTGAGGG - Intronic
943750117 2:191502137-191502159 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
944112502 2:196148265-196148287 CCCTTCTCAAGGTCTCCTGAGGG + Intronic
944124936 2:196282418-196282440 ACATTCTCAGGATCTCTTGAGGG - Intronic
944551842 2:200851287-200851309 ATGTCCTCAGGACCTCCTGAGGG - Intergenic
944720478 2:202418490-202418512 ATGTTCTCAGGATTGCCTGAGGG - Intronic
945114656 2:206399636-206399658 ATGTTCTCAGGATCTCCTGGGGG - Intergenic
945742515 2:213680735-213680757 ATGTTCTCAGGACCTCCTAAGGG - Intronic
945743144 2:213687960-213687982 ATGTCCTCAGTTCCTCCTGAGGG - Intronic
946232753 2:218302762-218302784 GTGTTCTCAGGGTCTCCTGAGGG - Intronic
946943981 2:224800795-224800817 ATGTTCTCAGGGTTTCCTGAGGG - Intronic
947171796 2:227320060-227320082 ATGTTCTCAGGACCTCCTGAAGG - Intergenic
947172337 2:227324358-227324380 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
947664936 2:231899304-231899326 ATGTTTTGAGGGTCTACTGCGGG + Intergenic
947667614 2:231917066-231917088 CTGTTCTCTGTGTATCCTGAAGG - Intergenic
947949764 2:234136967-234136989 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
947975500 2:234362354-234362376 ATATCCTCAGGGTCTCCTGAGGG + Intergenic
948011113 2:234649766-234649788 GTGCTCTCAGTATCTCCTGAGGG - Intergenic
948016387 2:234694207-234694229 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
948020068 2:234724743-234724765 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
948091040 2:235295991-235296013 GTGTTCTCAGGATTTTCTGAGGG - Intergenic
948182322 2:235992103-235992125 CTGTTATCTGGGTCTCGTGATGG - Intronic
948524342 2:238560900-238560922 GTGTTTTCAGGGGCTCCTGCTGG + Intergenic
948819727 2:240535133-240535155 ATGTTCTGAGGACCTCCTGAGGG - Intronic
949030091 2:241791130-241791152 ATGTTCTGAGGACCTCCTGAGGG + Intronic
1168747167 20:253529-253551 ATGTTCTCAGGACTTCCTGAGGG - Intergenic
1168824867 20:803397-803419 GTGTTCTCAGGACCTCCTAAGGG - Intergenic
1168843745 20:927581-927603 ATGTTCTCAGGACCTCCTGACGG - Intergenic
1169160774 20:3376536-3376558 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1169245377 20:4020534-4020556 ATGTTCTCAAGATCTCATGTGGG + Intergenic
1169304384 20:4475788-4475810 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1169324043 20:4661020-4661042 ATGTGCTCAGGACCTCCTGAGGG - Intergenic
1169631589 20:7638412-7638434 ATGTTCCCAGGATCTCCTGAGGG + Intergenic
1170659433 20:18322601-18322623 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1171158294 20:22897156-22897178 CTGTTCTCAGGGTCTGTTGATGG + Intergenic
1172227001 20:33311747-33311769 CTGTTCTCAGGGTCTGCTTCTGG + Intergenic
1172566772 20:35936936-35936958 ATGTTCTCAGGACTTCCTGAGGG - Intronic
1172796141 20:37539730-37539752 ATGTTCCCAGCACCTCCTGAGGG - Intergenic
1173746382 20:45440498-45440520 ACATTCTCAGGATCTCCTGAGGG + Intergenic
1173841416 20:46159659-46159681 ATGCTGTCAGGGTTTCCTCAAGG - Intergenic
1174408645 20:50319675-50319697 ATGGTCACAGGGTCTCCTTTTGG + Intergenic
1174888639 20:54364405-54364427 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1174956210 20:55101673-55101695 ATGTTCTTAGGACTTCCTGAGGG - Intergenic
1175058066 20:56216261-56216283 TGGTTCCCAGGATCTCCTGAGGG + Intergenic
1175335355 20:58192673-58192695 ATGCTGTCAGGGTCTCCAGCAGG - Intergenic
1175734382 20:61375131-61375153 ATGTTCTCATGATCTCCTGAGGG + Intronic
1175789227 20:61731228-61731250 CCATTCTGAGGGTCTCCTGAGGG + Intronic
1176095400 20:63341422-63341444 GTGTCCTCAGGACCTCCTGAGGG + Intergenic
1176343547 21:5720215-5720237 ATGTTCTCATGCTCTCCTCTAGG + Intergenic
1176361307 21:5998957-5998979 ATGTTCTCAGGACTTCCTGAGGG - Intergenic
1176501280 21:7604241-7604263 ATGTTCTCATGCTCTCCTCTAGG - Intergenic
1176537868 21:8118284-8118306 ATGTTCTCATGCTCTCCTCTAGG + Intergenic
1176780327 21:13185431-13185453 ATTTTCTTAGGGTTGCCTGATGG + Intergenic
1177156616 21:17507244-17507266 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
1177217552 21:18149948-18149970 ATGTTCTCACGACCTCCTGAGGG - Intronic
1177255879 21:18662312-18662334 GTGTTCTCAGGATCTCCTGAGGG + Intergenic
1177435646 21:21048738-21048760 ATGTTCTCAGGACTTCCTGAGGG + Intronic
1177977998 21:27874450-27874472 ATTTTCTTAGGGTTGCCTGATGG + Intergenic
1178031673 21:28534888-28534910 ATGTTCTTAGGACCTCCTCAGGG - Intergenic
1178135521 21:29622665-29622687 ATGTTCTAAAGGTCCCCTGTGGG + Intronic
1178179678 21:30145313-30145335 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1178321400 21:31608686-31608708 ATGTTCTGAGGACCTCCTGAGGG + Intergenic
1178386280 21:32153257-32153279 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1178513000 21:33222849-33222871 ATGTTCTTGGGATCTCTTGAGGG - Intergenic
1178570548 21:33731894-33731916 ATGGTCTCAGGATCTCCTGAGGG - Intronic
1178866325 21:36330562-36330584 ATGTTCTCAGGACCACCTGAGGG + Intronic
1179033512 21:37740633-37740655 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1179261504 21:39762259-39762281 CTGTCCTCAGGATCTCCTGAGGG - Intronic
1179460482 21:41531439-41531461 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1179619376 21:42602740-42602762 ATGTTCTCAGGAACTCCTGAGGG - Intergenic
1179649496 21:42798286-42798308 ATGTTCTCAAGACCTCCTGAAGG - Intergenic
1179762211 21:43539593-43539615 ATGTTCTCAGGACTTCCTGAGGG + Intronic
1179892411 21:44343148-44343170 ATGTTCTCAGGATTTCCTGAGGG - Intergenic
1179915083 21:44471874-44471896 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
1180135031 21:45856748-45856770 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1180178779 21:46107904-46107926 ATGTTCTCAGGACCTCCTAAGGG + Intronic
1180500600 22:15925715-15925737 ATGTTCTCAGGGTCTTCTGAGGG + Intergenic
1181304824 22:21909717-21909739 ATGTTCTCAGAACCTCCTGAGGG + Intergenic
1181329190 22:22075893-22075915 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1181424715 22:22826871-22826893 AAGCTCTCAGGGTCTCCTGAGGG + Intronic
1181425261 22:22833083-22833105 ATGTTCTCCGGGTGGCCTCATGG + Intronic
1182501477 22:30751233-30751255 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1183113173 22:35668327-35668349 ATGTTCTCAGGGTCTCCTGAGGG + Exonic
1183114140 22:35676606-35676628 AAGTTCTCAGGATCTCCTGATGG + Intergenic
1183244313 22:36682017-36682039 CAATTCTCAGAGTCTCCTGACGG - Intronic
1183423354 22:37724845-37724867 ATGTTCTGAGGTTCTCTTGTTGG - Exonic
1183520481 22:38293759-38293781 ATGCTCACAGGGGCTCCTGGGGG + Intronic
1183637457 22:39073083-39073105 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1183643765 22:39110182-39110204 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1183644586 22:39116852-39116874 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
1184338676 22:43872837-43872859 ATGTTCTTAGGATCTCCTAAGGG + Intergenic
1184848682 22:47105042-47105064 ATGCTCTCAGGACCTCCTGAGGG + Intronic
1184986128 22:48136631-48136653 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
1185044669 22:48523027-48523049 ATGGGCTCTGGGTCTCCTGCTGG - Intronic
1185079783 22:48703344-48703366 TGGTGCTCAGGGTCACCTGAAGG - Intronic
1203242815 22_KI270733v1_random:34639-34661 ATGTTCTCATGCTCTCCTCTAGG + Intergenic
949318278 3:2781548-2781570 ATGTTCTCAGGACCTCCTGAGGG - Intronic
949440002 3:4070277-4070299 ATGTTCTCAGGACCTTCTGAAGG + Intronic
949462181 3:4304829-4304851 ATGTTCTCAGCATCTCCTGAGGG - Intronic
949462564 3:4308910-4308932 ATGTTCTCAGGATCTCCTGATGG - Intronic
949611811 3:5710586-5710608 ATGTTCTCCGGACCTCCTGGGGG - Intergenic
949811402 3:8010925-8010947 ATGTTCTCTGGACCTCCCGAGGG - Intergenic
949927649 3:9054600-9054622 ATGTTTTCAGGATCTCCTGAGGG + Intronic
950025944 3:9819989-9820011 ATGTGCACGGGGTCTTCTGAAGG + Intronic
950411218 3:12838908-12838930 ATATTCTTAGGGTCTCCCAAGGG + Intronic
951138285 3:19130069-19130091 AAGTTCTCAGGACCTCCTGAGGG + Intergenic
951300893 3:20994959-20994981 ATGTTTTCAGGACCTCCTGAGGG - Intergenic
951332589 3:21384415-21384437 ATGTTCTCAGGATCTCCTGATGG - Intergenic
951644198 3:24868968-24868990 ATGTTCTCAGGATCTTCTGAGGG + Intergenic
951773306 3:26282531-26282553 ATGTTCTCAGGACCTCCTAAGGG - Intergenic
952107397 3:30086016-30086038 ATGTTCTCAGGACTTCCTGAGGG + Intergenic
952258391 3:31714945-31714967 ATATTCTCAGGATCTCCTGAGGG + Intronic
953381714 3:42477283-42477305 ATGTTGTCAGGGCCACCAGAGGG - Intergenic
953422289 3:42763857-42763879 GTGGTCTCAGGATCTCCTGAGGG - Intronic
953427355 3:42805770-42805792 ATGTTCTCAGGACCTCCTGAGGG - Intronic
953453991 3:43027871-43027893 CTGTTCTCAGGATCTCCTGAGGG - Intronic
953747801 3:45588323-45588345 ATATTCTCAGGATCTCCTGAGGG - Intronic
953890013 3:46744487-46744509 TTGTGCTCGGGGTCTCCTGGGGG - Intronic
954025969 3:47783191-47783213 ATGTTTTCAGGATCTCCTGAGGG + Intergenic
954119925 3:48491509-48491531 ATGTTCTCAAGACCTCCTGAGGG + Intronic
954604262 3:51896448-51896470 ATGTTCTCAGGACTTCCTGAGGG + Intronic
954961663 3:54570932-54570954 ATGTTCTTAGGACCTCCTGAGGG - Intronic
955516330 3:59729889-59729911 ATGTTCTCAGGGCCTCCTGAGGG + Intergenic
955612974 3:60777214-60777236 ATGTTCTCAGGACCTTCTGAGGG - Intronic
956119426 3:65951244-65951266 AAGTCCTCAGGGTCTGCTGGGGG - Intronic
956716018 3:72080712-72080734 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
956986421 3:74706645-74706667 AGGTTGTCAGGATCTCCTGAGGG - Intergenic
957208952 3:77236048-77236070 ATGTTCTCAGGGTCTCCTGAGGG - Intronic
957297035 3:78345775-78345797 ATGTTCTCTGGCCCTCCTGAGGG - Intergenic
957297668 3:78353710-78353732 ATGTTCTCTGGATCTCCCGAGGG + Intergenic
957299677 3:78375852-78375874 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
957305269 3:78449693-78449715 ATATTCTCAGGTTCCCCTGAGGG + Intergenic
957465220 3:80581171-80581193 ATGCTTTCAGGACCTCCTGAGGG - Intergenic
957600236 3:82324380-82324402 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
957672177 3:83319453-83319475 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
957737816 3:84225296-84225318 ATGTTTTCAGAACCTCCTGAGGG + Intergenic
957965191 3:87313223-87313245 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
957983919 3:87548028-87548050 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
958566451 3:95817295-95817317 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
958573764 3:95921016-95921038 TTGTTTTCAGGATCTCCTGAGGG - Intergenic
959052991 3:101542152-101542174 ATGTTCTCAGGACCTCCCAAGGG - Intergenic
959062720 3:101630671-101630693 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
959296834 3:104545945-104545967 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
959405979 3:105962143-105962165 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
960723624 3:120648756-120648778 ATGTTCTCAGGATCTCCTGAGGG + Intronic
960723822 3:120650360-120650382 ATGTTCTCAGGATCTCCTGATGG + Intronic
961164174 3:124752045-124752067 ATGTTCTTGGGACCTCCTGAGGG + Intergenic
961322491 3:126085273-126085295 ATGTTCTCAAGACCTCCTGAAGG + Intronic
961344186 3:126251168-126251190 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
961353227 3:126316884-126316906 ATGTTCTCATGCCTTCCTGAGGG - Intergenic
961794336 3:129398790-129398812 ATGTTCTCAGGACTTCCTGAGGG + Intergenic
961800712 3:129446708-129446730 ATGTTCTCAGGACCACCTGAGGG + Intronic
961800747 3:129447205-129447227 ATGTTCTGTGGACCTCCTGAGGG - Intronic
961839415 3:129696461-129696483 ATGTTCTCAAAACCTCCTGAGGG + Intronic
961957487 3:130818974-130818996 ATGTTCTCAGGCTCTCCCGAGGG + Intergenic
962040956 3:131707005-131707027 ATGTTCTCAGGTTTTCCTGAAGG + Intronic
962147539 3:132856279-132856301 ATGTTGTCAGGGTCTGCAGGAGG + Intergenic
962272532 3:133988532-133988554 ATGTTCTCAGGACTTACTGAGGG + Intronic
962467776 3:135676162-135676184 ATGTTCTCAGGCTCTCCTGAGGG + Intergenic
963086224 3:141438922-141438944 CTGTTCTCAGGGGCTAATGAGGG - Intronic
963191976 3:142482951-142482973 ATGTTCTCAGGATCTCCTGAGGG - Intronic
963353608 3:144182349-144182371 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
963412739 3:144952707-144952729 ATGTTTTCAGTACCTCCTGAGGG - Intergenic
963433233 3:145235919-145235941 ATGTTCTCAGGGCCTCCTGCGGG + Intergenic
963467696 3:145703353-145703375 CGTTTCTCAGAGTCTCCTGAAGG + Intergenic
963760307 3:149281557-149281579 ATGTTCTCAGGTCCTCCTAAGGG - Intergenic
964366670 3:155957862-155957884 CTGTTCTCAGGGTCTCCAGTGGG + Intergenic
964458710 3:156897392-156897414 ATGTTCTCAGGACCTCCTGAGGG - Intronic
964557883 3:157960827-157960849 ATGGTCTCAGGGTTTCAAGATGG + Intergenic
964612709 3:158631099-158631121 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
964845623 3:161041379-161041401 ATGTTCGCAGGATCTCCTGAGGG + Intronic
964935164 3:162075563-162075585 ATGTTCTCAGGGTATCCTGAAGG + Intergenic
965080533 3:164025602-164025624 AAATCCTCTGGGTCTCCTGAAGG + Intergenic
965180454 3:165395748-165395770 ATGTTCTCAGGAACTCTTGAGGG + Intergenic
965534603 3:169812096-169812118 GTGCTCTCAGGGTCTCCGGGAGG - Intronic
965556603 3:170024859-170024881 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
966913275 3:184570852-184570874 ATGGCCGCAGGGTCTCCTGTAGG + Intronic
966952456 3:184834206-184834228 AGGTTCTCATGTTCTCCAGAAGG - Intronic
967212698 3:187182655-187182677 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
967636361 3:191806574-191806596 ATGTTCCCAGGCCCTCCTGAGGG + Intergenic
967755435 3:193163135-193163157 ATGTTCCCAGGACCTCCTGAGGG + Intergenic
968363128 3:198163010-198163032 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
968924569 4:3540279-3540301 ATGTTCTCAGGACCTCCCGGGGG + Intergenic
969186751 4:5480299-5480321 ATGTTCTCAGGACCTCCTGAGGG - Intronic
969578470 4:8050188-8050210 CTGTTCTCAGGGTCACATGAGGG + Intronic
969858202 4:10016740-10016762 GTGTTCTCAGGACCTCCTGAGGG + Intronic
969960987 4:10944720-10944742 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
970054134 4:11951600-11951622 GTGTTCTCAGCATCTCCTGAGGG + Intergenic
970082166 4:12299840-12299862 ATGCTCTCAGAACCTCCTGAGGG - Intergenic
970205720 4:13653929-13653951 ATGTTCTCAGGATCTCCTGAAGG + Intergenic
970367921 4:15379697-15379719 ATGTTGACATGGTCTCCTTAGGG + Intronic
970711664 4:18870795-18870817 ATGCTCTCAGGACATCCTGAGGG + Intergenic
970816662 4:20164147-20164169 ATGTTTTCAGGATCTCCTGAGGG + Intergenic
970878793 4:20903716-20903738 ATGTTCTCAGGATCTCCTGAGGG + Intronic
971076421 4:23154153-23154175 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
971333318 4:25700367-25700389 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
971713600 4:30148373-30148395 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
971752005 4:30662390-30662412 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
971998043 4:33992928-33992950 ATTTTCTTAGGATCTCTTGAGGG - Intergenic
972566306 4:40272388-40272410 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
972778892 4:42267903-42267925 TTGTTCTCAGGATCTCTTGAGGG + Intergenic
972839717 4:42916232-42916254 TTGCTCTCTGGGTCTGCTGAGGG - Intronic
972912322 4:43832582-43832604 AGGTTCTCAGGACCTCCTGAGGG + Intergenic
973224992 4:47774204-47774226 ATCTTCTCAGCATCTCCAGATGG - Intronic
973245943 4:48011598-48011620 ACGTTCTCAGGACCTCCTGAGGG - Intronic
973336928 4:48966044-48966066 ATGTTCTCAGGAGCTGCTGAGGG + Intergenic
973574216 4:52269720-52269742 ATGGTCTCAGGACCTCCTGAGGG + Intergenic
973637794 4:52876102-52876124 ATCTCCTCAGGGTCTGCTGATGG - Intronic
974460069 4:62175984-62176006 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
974578696 4:63765745-63765767 ATGTTTTCAGAGTTTTCTGATGG + Intergenic
974594926 4:64002145-64002167 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
974627040 4:64439446-64439468 ATGTTCTCAGGACCTTCTGAGGG - Intergenic
974868932 4:67614337-67614359 ATGTTCTCTGGACCTCCTGAGGG + Exonic
974878256 4:67723155-67723177 ATGTTTTCAGGGTCTCCTGAGGG + Intergenic
974980664 4:68953490-68953512 ATGTTCTTAGGGTCTCTGGAGGG + Intergenic
975002421 4:69240901-69240923 ATGTTCTTAGGATCTCCTGAGGG - Intergenic
975010526 4:69344892-69344914 ATGTTCTTAGGATCTCCTGAGGG - Intronic
975084008 4:70315546-70315568 AGCTACTCAGGGTCTACTGATGG + Intergenic
975191779 4:71472265-71472287 ATGTCATCACGGTCTACTGAGGG - Intronic
975224459 4:71855740-71855762 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
975346403 4:73296943-73296965 ATGTTCTCGGGACCTCTTGAGGG + Intergenic
975437397 4:74368807-74368829 GTGTTCTCATTGTCTCCCGATGG - Intronic
975614886 4:76236514-76236536 ATGTTCTCAGGATCTCCTGAGGG - Intronic
975666205 4:76737686-76737708 ATGTTCTCAGGACGTCCTGAGGG - Intronic
975797591 4:78025455-78025477 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
975947790 4:79728538-79728560 ATGTTCTCAGGATCTCCTAAGGG + Intergenic
976112036 4:81685899-81685921 ATGTTCTCAGGATCTCCTGAGGG - Intronic
976127147 4:81845724-81845746 ATGTTCTCAGGATCTCTTGAGGG + Intronic
976499292 4:85768843-85768865 ATCCTTTCAGGGTCTCCTGCTGG + Intronic
976598091 4:86913150-86913172 ATGTTCTCAGTGTTTCCTTGGGG + Intronic
976970749 4:91099521-91099543 GTGTTCTCAGGGCCTCCTGAGGG - Intronic
977002971 4:91526446-91526468 ATGTTCTCAGGACCTCCTGAGGG + Intronic
977070102 4:92374512-92374534 ATGTTCTCAGGACCTCCTGAGGG + Intronic
977345515 4:95811724-95811746 ATGTTCTCAGGATCTCCTGAAGG + Intergenic
977480769 4:97571765-97571787 AAGTTCTCAGGACCTCCTGAGGG + Intronic
977525544 4:98141696-98141718 ATGTTCTCAGGACCTCCTGAGGG + Intronic
977985238 4:103375286-103375308 ATGTTCTCAGGACTTCCTGAGGG + Intergenic
978000367 4:103550390-103550412 ATGTTCTGAGGGTCTCCTGAAGG - Intergenic
978162406 4:105564855-105564877 ATGTTCTCGGGATCTCCAGAGGG - Intronic
978337437 4:107684834-107684856 ATGTTCTCAGGACCTCCTGAGGG + Intronic
978727419 4:111985547-111985569 TTGTTATCAAGGACTCCTGAGGG + Intergenic
979239954 4:118439236-118439258 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
979251481 4:118571186-118571208 ATTTTCTCAGGATCACCTGATGG - Intergenic
979289104 4:118960130-118960152 ATGTTCTCCTAGTCTCCAGAGGG + Intronic
979483960 4:121249459-121249481 ATGGTGTCAGCCTCTCCTGAGGG + Intergenic
979755729 4:124338350-124338372 ATACTCTCTGGATCTCCTGATGG - Intergenic
979770825 4:124523029-124523051 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
980052781 4:128054858-128054880 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
980081811 4:128351967-128351989 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
980480234 4:133378319-133378341 ATATTCTCAGAGTCTACTGAGGG - Intergenic
980984951 4:139686015-139686037 GTGTTCTCAGGACCTCCTGAGGG - Intronic
981292812 4:143096130-143096152 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
982251728 4:153413948-153413970 ATGTCCTCAGCATCTCCTGGGGG - Intronic
982391718 4:154871901-154871923 ATGTTCTCAGGATCTTCTGAGGG - Intergenic
982449363 4:155533613-155533635 ATGTTCTCAGGCTGCCCTGAGGG + Intergenic
982939008 4:161524389-161524411 ATCTTCTCATGACCTCCTGAGGG + Intronic
983273771 4:165593068-165593090 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
983327513 4:166276283-166276305 ATATTTTCAGGATCTCCTTATGG - Intergenic
983343329 4:166494530-166494552 ATGTTCTCAGGACCTCCTAATGG + Intergenic
983492283 4:168401503-168401525 ATGTTCTCAGGATCTCCTGTGGG + Intronic
983638220 4:169919588-169919610 ATGTTCTCAGGATCTCCTGATGG + Intergenic
983740126 4:171120401-171120423 ATGTTGTCAGGTTCTTCTCAAGG - Intergenic
983822737 4:172216768-172216790 ATGTTCTCGGGACCTCCTGAGGG - Intronic
983863750 4:172738683-172738705 GTGTTCTCAGGATCTCCTAAGGG - Intronic
984049103 4:174841834-174841856 ATGTTCTCAGGACCTCCCGAGGG - Intronic
984073827 4:175150430-175150452 ATGTTGTCAGTATCTCCTGAGGG + Intergenic
984364482 4:178781071-178781093 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
984393304 4:179166331-179166353 ATGTTCTCAGGACCTACTAAGGG + Intergenic
984437996 4:179728185-179728207 ATAGTCTCAGGCCCTCCTGAGGG - Intergenic
985135918 4:186786056-186786078 ATGTTCTCAGGTTCTGGGGAAGG + Intergenic
985251470 4:188028532-188028554 ATGTCCTTAGGATCTCCCGAGGG - Intergenic
985285126 4:188329468-188329490 ATGTTCTCAGAACCTCCTGAGGG - Intergenic
985482813 5:127804-127826 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
985483038 5:129555-129577 ACATTCTCAGGATCTCTTGAGGG + Intergenic
985768649 5:1795536-1795558 ATGTCCTCCCTGTCTCCTGAAGG - Intergenic
986646933 5:9925884-9925906 TTGTTCTCAGGACCTCCTGAGGG + Intergenic
986893042 5:12332336-12332358 GTGTTCTCAGGACCTCCTGAGGG - Intergenic
987346212 5:16981104-16981126 GTGTTCTCAGCATCTCCAGAGGG + Intergenic
987356616 5:17068922-17068944 ATGTTCTCAGGACATCCTGAGGG + Intronic
988017354 5:25575999-25576021 ATGTTCTCAGAAGCTCCTGAGGG + Intergenic
988314088 5:29601511-29601533 ATGTTCTCAGGAACTCCTGAGGG + Intergenic
988365627 5:30294737-30294759 ATGTTCTCAGAACCTTCTGAGGG + Intergenic
988568027 5:32336090-32336112 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
988633197 5:32952904-32952926 AAGTTCTCAGGACCTTCTGAAGG + Intergenic
988637794 5:33005874-33005896 ATGTTCTCAGGATCTTCTGAGGG + Intergenic
988771236 5:34435166-34435188 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
988801674 5:34701716-34701738 ATGTTCTCAGGACCTCCTGAGGG + Intronic
988831431 5:34990898-34990920 ATGTTCTTGGGGTCTCCTGAGGG + Intergenic
988927513 5:36004387-36004409 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
989183419 5:38600292-38600314 ATATTCTCAGGATCTTCTGAGGG + Intronic
989445724 5:41526188-41526210 ACGCTCTTAGGATCTCCTGATGG - Intergenic
989541611 5:42625508-42625530 ATGTTCTCAGGACCTCCTGAGGG - Intronic
989564088 5:42884188-42884210 ATGTCCTCAGTATCTCCTGAGGG + Intronic
989568816 5:42926284-42926306 ATGTTTTCAGGATCTCCTGAGGG - Intergenic
989578619 5:43011450-43011472 ATGTTCTCAGGATCTCCTGATGG - Intergenic
989830169 5:45907106-45907128 ATGTTCTCAGGACCTCTTGAGGG - Intergenic
990006995 5:50955188-50955210 ATGTTCTTAGGACCTCCTGAGGG + Intergenic
990307580 5:54508043-54508065 ATGTTTTCAGGCCCTCCTGAGGG - Intergenic
990614163 5:57490147-57490169 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
990741134 5:58913928-58913950 ATGTTCTCAGGACCTCCCGAGGG + Intergenic
991424784 5:66479201-66479223 ATGTTCTCAGGATCTCCTAAGGG + Intergenic
991644830 5:68791398-68791420 ATGTTCTCAGGACCTCCTGGGGG - Intergenic
991737075 5:69637520-69637542 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
991739511 5:69655553-69655575 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
991757991 5:69897626-69897648 CTGGTTTCAGGATCTCCTGAGGG - Intergenic
991788649 5:70217244-70217266 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
991791086 5:70235294-70235316 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
991813399 5:70492349-70492371 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
991816531 5:70513630-70513652 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
991818971 5:70531671-70531693 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
991837394 5:70773508-70773530 CTGGTTTCAGGATCTCCTGAGGG - Intergenic
991881095 5:71217608-71217630 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
991883532 5:71235629-71235651 CTGGTTTCAGGATCTCCTGAGGG + Intergenic
992283072 5:75202146-75202168 ATGTTCTCAGAGTTTCCTGACGG + Intronic
992453485 5:76894375-76894397 ATGTTCTCAGGACCTCCTGAGGG + Intronic
992733124 5:79691775-79691797 ATGTTCTCAGGATCTCCTGCAGG - Intronic
992856102 5:80863275-80863297 ATGTTCTCAGGACCTCCTGAGGG - Intronic
992930100 5:81634468-81634490 ATGTTCTCAGGACCTCCCAAGGG + Intronic
993749122 5:91645074-91645096 TTATTCTCAGAGTCTCCTGAGGG + Intergenic
993965425 5:94354882-94354904 ATGTTCCCAGGACCTCCTGAGGG - Intronic
994553481 5:101265993-101266015 ATGTTCTCAGGACCTCCTTGAGG - Intergenic
995105179 5:108369403-108369425 ATGTTCTCAGGATCTCCTGAGGG + Intronic
995127862 5:108597823-108597845 TTGTTCTCAGGATCTCCTGAAGG - Intergenic
995129023 5:108610116-108610138 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
995285724 5:110386093-110386115 ATGTTCTCAGGATCCCCTGAGGG + Intronic
995593420 5:113723657-113723679 ATGTTCTTAGGAGCTCCTGAGGG - Intergenic
995663326 5:114510724-114510746 ATGGTCTCAGGGTCTCCTAAGGG + Intergenic
995741308 5:115358728-115358750 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
995823334 5:116263883-116263905 ATGTTCTCAGGACCTCCTGAGGG + Intronic
996063367 5:119055790-119055812 ATGTTCTCAGGATCTCCTAAGGG - Intronic
996123987 5:119704821-119704843 ATGTTCTCAGGACTTCTTGAGGG + Intergenic
996380668 5:122859707-122859729 ATGTTCTCAAGACTTCCTGATGG - Intronic
996478356 5:123946602-123946624 ATTTTCTCAGGACCTCCTGAGGG + Intergenic
996808160 5:127481612-127481634 ATGTTCTCAGAGTCTCCTGAGGG - Intergenic
996964703 5:129294210-129294232 ATGTTCTCAGGACCTCCAGAGGG - Intergenic
997258100 5:132444599-132444621 ATGTTCTCAGGATCTCCTGAGGG - Intronic
997353760 5:133249109-133249131 CTGTTCTCAGGGTCACCTCCAGG + Intronic
997458314 5:134034145-134034167 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
997756734 5:136406648-136406670 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
998066834 5:139166047-139166069 ATGTTCTCAGGACCTCCTGAGGG + Intronic
998262020 5:140638942-140638964 ATGTTCTCAGGACCTCCTGAGGG + Intronic
998727278 5:145031922-145031944 ATGTTCTCAGAACCTCCTGAGGG + Intergenic
999415166 5:151388596-151388618 ATGTCCTCAGTGTCTCTTGAGGG + Intergenic
999558472 5:152772419-152772441 ATATTGTCAGGACCTCCTGAAGG - Intergenic
999729809 5:154468209-154468231 CTGGTCTCAGGGTGCCCTGAAGG + Intergenic
999785879 5:154890371-154890393 ATGCTCTCAGGGCCTCCTGAGGG - Intronic
1000363778 5:160472433-160472455 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1000657160 5:163893334-163893356 CTGTTCTCCAGGTCTCTTGAGGG + Intergenic
1000823904 5:166020254-166020276 ATGTTCTTAGGAAGTCCTGAGGG - Intergenic
1001042426 5:168346439-168346461 ATTTTCTGAGGGTCTCTTGAGGG - Intronic
1001042486 5:168346918-168346940 ATTTTCTGAGGGTCTCTTGAGGG + Intronic
1001226399 5:169948036-169948058 GAGCTCTCTGGGTCTCCTGAAGG - Intronic
1001282584 5:170397754-170397776 ATATTCTCAAGGTCTCCTGAGGG - Intronic
1001634811 5:173202300-173202322 ATGTCCTCAGGGTTTCCTGAGGG + Intergenic
1001753748 5:174150631-174150653 ATGTGCTCAGGGGCTCTGGAAGG + Intronic
1001834950 5:174824099-174824121 AGGCTCTGAGGGGCTCCTGAGGG - Intergenic
1001918951 5:175585619-175585641 ACCTTCTCTGGGTCTCCCGAGGG + Intergenic
1002740208 5:181429821-181429843 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1003068022 6:2919827-2919849 GTGTTCTCAGGATCTCCTGAGGG - Intergenic
1003195836 6:3913790-3913812 GTGTTCTCAGGATCTCCTGAGGG - Intergenic
1003202403 6:3973943-3973965 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1003204157 6:3991833-3991855 ATGTTCTCAGGATCTCGTGAGGG + Intergenic
1003231850 6:4261064-4261086 ATGTTTTCAGGACCTCCTGAGGG + Intergenic
1003475496 6:6478345-6478367 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1003674910 6:8193980-8194002 ATGTTCTCAGGGTCTCCTGAAGG + Intergenic
1003711783 6:8600957-8600979 ATGTTAGCTGAGTCTCCTGAAGG + Intergenic
1005285558 6:24322869-24322891 AAGTTCTCAAGATCTCCTGAGGG + Intronic
1005363227 6:25052580-25052602 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1005449191 6:25956527-25956549 TTGTTCTCAGGACCTCCTGAGGG - Intergenic
1005491847 6:26354453-26354475 ATGTTTTCAGGATCTCCTGAGGG - Intergenic
1005652844 6:27900353-27900375 GTGTTCTTAGGACCTCCTGAGGG + Intergenic
1005829244 6:29657320-29657342 CTGTTTTCAGGGTCTCCCCAGGG - Intronic
1005888929 6:30120459-30120481 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1006042087 6:31264901-31264923 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
1006051632 6:31349765-31349787 ATGTTCTCAGGGTCTCCTGAGGG - Intronic
1006413682 6:33890981-33891003 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1006766298 6:36509858-36509880 ATCTACTCCGGGTCTCCTAAGGG - Intronic
1006993692 6:38238219-38238241 TTGTTCTCAGGACCTCCTGAGGG - Intronic
1007012871 6:38434579-38434601 ATGTTGTCAGGGTCTCCTGAGGG + Intronic
1007311462 6:40949552-40949574 ATGTTCTCAGGGTCTCCTAAGGG + Intergenic
1007861642 6:44915905-44915927 ATGTTCTCAGGACCTCCCAAGGG + Intronic
1008578388 6:52883037-52883059 ACGTTCCCAGAATCTCCTGAGGG - Intronic
1008730302 6:54473955-54473977 ATGTTCTCATGGTCTCCTGAAGG + Intergenic
1009357124 6:62764702-62764724 ATGTTCTCGGGACCTCCTGAGGG - Intergenic
1009788699 6:68371781-68371803 CTCTTCTTAGGGTCTCATGAGGG + Intergenic
1009908180 6:69894090-69894112 ATGTTCTCAAGACCTCCTGAGGG + Intronic
1009997173 6:70908824-70908846 AAATTCTCAGGTTCTCCTGGTGG + Intronic
1010383292 6:75248623-75248645 ATGTTCCCAGGATCTCCTGAGGG + Intronic
1011121281 6:83956224-83956246 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1011750680 6:90451778-90451800 ATGTTCTCAGGATCTCTTGAGGG + Intergenic
1012205756 6:96458500-96458522 ATGTTCCCAAGATTTCCTGAGGG - Intergenic
1012249155 6:96960667-96960689 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1012432480 6:99179119-99179141 ATGTTATCAGGATCTCCTGGAGG + Intergenic
1013211259 6:107988953-107988975 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1013412671 6:109895772-109895794 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1013476048 6:110508277-110508299 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1013582530 6:111550502-111550524 ATGTTATCAGTGACTTCTGAGGG + Intergenic
1014159915 6:118156317-118156339 ATGTTCTCAGGCCCTCCTGAGGG - Intronic
1015288739 6:131513066-131513088 ATGTTCTCAGAATCTTCTGAGGG + Intergenic
1015327572 6:131940962-131940984 AAGTTCTCAGGACCTCTTGAGGG - Intergenic
1015681731 6:135815973-135815995 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1016547249 6:145238208-145238230 ATGTTCTCACGACCCCCTGAGGG + Intergenic
1016557861 6:145359945-145359967 ATGTTCTCAGGACCACCTGGGGG - Intergenic
1016602469 6:145877999-145878021 ATGTTCTCAGGACCACCTGAGGG + Intronic
1016854262 6:148650756-148650778 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1016964954 6:149710215-149710237 ATGTTCTCAGGAGCTCCTGAGGG + Intronic
1017349082 6:153418715-153418737 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1017863393 6:158420967-158420989 ATGTTCTCAGGACTTCCTGAGGG - Intronic
1018031701 6:159846326-159846348 ATGATCTCAGGGTCTCCGCTCGG + Intergenic
1018155619 6:160982857-160982879 ATGTTCTCAGGATCCCCTGGGGG + Intergenic
1018190036 6:161302545-161302567 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1018260457 6:161965593-161965615 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1018486952 6:164250250-164250272 ATGTTCTAAGGATCTCCTGAGGG + Intergenic
1018561294 6:165103272-165103294 ATGTTCTCGGGACCTCCTGAGGG - Intergenic
1018807476 6:167272503-167272525 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1018835787 6:167482693-167482715 ATATTCTCAGGACTTCCTGAGGG - Intergenic
1018890588 6:167978662-167978684 ACGTTCTCAGGACCTTCTGAGGG - Intergenic
1018992211 6:168682837-168682859 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1019030338 6:169004657-169004679 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1019030471 6:169006122-169006144 ATGTTCTCAGGACCTCCTAGGGG - Intergenic
1019041831 6:169112304-169112326 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1019063011 6:169270539-169270561 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1019099701 6:169619458-169619480 ATGTTCTGAGGACCTCCTGAGGG - Intronic
1019106909 6:169675498-169675520 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1019107361 6:169679241-169679263 ACGTTCTCAGGACCTCCTGAGGG + Intronic
1019126162 6:169841320-169841342 ATGTTCTCAGGGAGTGCTGATGG + Intergenic
1019151469 6:170008840-170008862 GTGTTCTCAGGACCTCCTGAGGG - Intergenic
1019156303 6:170041155-170041177 ATGTTCTCAGGACCTCCAGAGGG + Intergenic
1019159779 6:170062294-170062316 AGGTTTTCAGGGTGTCCTGTGGG - Intergenic
1019245321 6:170705421-170705443 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1019252553 7:25702-25724 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1019296266 7:276929-276951 ATGTTCTCAGGACCTCTGGAGGG + Intergenic
1019914978 7:4127383-4127405 ACGTTCTCAGGGGCGGCTGAAGG - Exonic
1020610545 7:10391161-10391183 ATGTTCTCACCACCTCCTGAGGG + Intergenic
1020760419 7:12261980-12262002 TTGTTGTGAGGGTGTCCTGAGGG + Intergenic
1020938337 7:14497507-14497529 ATGTTCCTAGGCTCTCCTAATGG + Intronic
1020958432 7:14772177-14772199 ATGTTCTCAGAACCTCCTGAGGG + Intronic
1020985376 7:15127184-15127206 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1021099860 7:16575183-16575205 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1021102044 7:16595481-16595503 GTGGTCTCAGGACCTCCTGAGGG - Intergenic
1021387672 7:20051577-20051599 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1021509415 7:21419374-21419396 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1021645875 7:22789099-22789121 ATGTTCTCAGGACCTACTGAGGG - Intergenic
1021673606 7:23058189-23058211 GTGTACTCAGGACCTCCTGAGGG + Intergenic
1021738686 7:23663781-23663803 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1021978289 7:26030270-26030292 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1022202499 7:28130654-28130676 ATCTACTCAGGGTTTTCTGAAGG + Intronic
1022822489 7:33974801-33974823 ATGTTCCCAGGGTGTCCTTTGGG + Intronic
1022902026 7:34820584-34820606 ATATTCTCATGACCTCCTGAGGG - Intronic
1022985403 7:35649501-35649523 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1023293478 7:38691382-38691404 ACGTTCTCAGAATCTCCTGAAGG - Intergenic
1023411684 7:39894438-39894460 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1023540679 7:41262007-41262029 ATCTTCTCAGCGTCTCTTTAAGG - Intergenic
1023648138 7:42340711-42340733 ATGTTCTCCTGACCTCCTGATGG - Intergenic
1023667540 7:42540557-42540579 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1024276478 7:47681119-47681141 ACGTTCTCAAGATCTCCTGAGGG + Intergenic
1024329840 7:48144767-48144789 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1024329972 7:48145875-48145897 ATGTTCTCAGGACCTCATGAGGG + Intergenic
1024465347 7:49706324-49706346 ATGTTCTCTAAGTCACCTGAGGG - Intergenic
1024582006 7:50808194-50808216 GTGTTCTCAGGATCACCTGTGGG + Intergenic
1024776897 7:52798242-52798264 ATGTTCACAGATTCTCCTGGAGG + Intergenic
1025005368 7:55350082-55350104 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1025953970 7:66168596-66168618 ATGTTCTCGGGATCTCCTGAGGG - Intergenic
1026143162 7:67723396-67723418 ATGTTCTCAGGACTTCCTGAGGG + Intergenic
1026496615 7:70909111-70909133 ATGTTCTCAGGACCCCCTGAGGG - Intergenic
1026520199 7:71110805-71110827 ATGTTCTCAGGAGCTCCTGAGGG - Intergenic
1026562262 7:71460112-71460134 ATGTTCTTAGGACCCCCTGAGGG + Intronic
1026606487 7:71820404-71820426 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1027413106 7:77943564-77943586 ATGTTCTCAGGGTCTCCTGAGGG + Intronic
1027517180 7:79156725-79156747 ATGTTTTCAGGACCTCTTGATGG + Intronic
1027517870 7:79164831-79164853 ATGTTCTCAGGACCTCCTAAGGG + Intronic
1027601551 7:80246589-80246611 ATGTTCTTAGGACCTCCTGAGGG - Intergenic
1027979370 7:85197601-85197623 ATGTTCTGAGGACCTCCTGAGGG + Intergenic
1028281715 7:88937964-88937986 ATGTTCCCAGGACCTCCTGAGGG - Intronic
1028456527 7:91044103-91044125 ATGTTCTCAAGATCTCCTGAGGG - Intronic
1028914401 7:96242878-96242900 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1028982918 7:96986865-96986887 ATGTTCTCAACATCTCCTAAAGG + Intergenic
1029328333 7:99829344-99829366 ATGTTCTTAAGACCTCCTGAAGG - Intronic
1029332285 7:99868808-99868830 ATGTTCTCAAGACCTCCTGAGGG + Intergenic
1029931227 7:104373543-104373565 ATGTTCCCAGGACCTCTTGAGGG - Intronic
1030096058 7:105900805-105900827 ATGTGCTCACTGTCTCCTGTGGG - Intronic
1030118121 7:106079192-106079214 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1030396282 7:108990682-108990704 ATATTCTCAGGAGCTCCTGAGGG - Intergenic
1030495133 7:110289165-110289187 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1030985032 7:116231424-116231446 ATGTTCTCAGAGTCTCCTCAGGG - Intronic
1031081147 7:117258082-117258104 ATGTTCTCGGTATCTCCTGAGGG - Intergenic
1031227102 7:119053579-119053601 ATGTTCTTGGGACCTCCTGAGGG - Intergenic
1031620233 7:123926559-123926581 ATGTTCTCAGGACCTCCTAAGGG - Intronic
1032420354 7:131774399-131774421 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1032612141 7:133426017-133426039 GTGTTCTCAGGATCTCATGAGGG + Intronic
1033122485 7:138678308-138678330 ACGTTCTCAGGACCTCCTGAGGG + Intronic
1033162958 7:139013330-139013352 ATGTTCTGAGGATCTCCCGAGGG + Intergenic
1033175757 7:139122269-139122291 ATGTTCTCAGGATCTCCCAAGGG - Intergenic
1033412338 7:141129703-141129725 CTGTTCTCAGGCCCTCCTGAGGG - Intronic
1033627790 7:143127910-143127932 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1033635381 7:143207233-143207255 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1034015870 7:147585928-147585950 ATATTCTCAGGATCTCCCAAGGG - Intronic
1034579091 7:152026882-152026904 ATGCTCTCAGGATCTCTTGAGGG + Intronic
1034681700 7:152933852-152933874 ATGTTCTCACAATCTCCTGCGGG + Intergenic
1034971493 7:155422507-155422529 ATTTTCTGAGGGTCTCTGGAGGG - Intergenic
1035157848 7:156928789-156928811 ATGTTCTCAGGGTCTCCGGAGGG - Intergenic
1035207717 7:157305203-157305225 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1035209309 7:157316062-157316084 ATGTTCTCAGGACCTCCTGGGGG + Intergenic
1035346321 7:158201915-158201937 ATGTTCTCAGGGCCTCCTGAGGG + Intronic
1035502806 8:102781-102803 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1035682462 8:1497932-1497954 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1035835133 8:2741910-2741932 ATGTTCTCAGGACCTCCTGAAGG + Intergenic
1035952156 8:4033621-4033643 TTGTTCTCAGGACCTCCTGAGGG + Intronic
1036052245 8:5212712-5212734 ATGTTCCCAGGACCTGCTGAGGG - Intergenic
1036295236 8:7529390-7529412 ATGTTCTGAGGACCTCCTGAGGG - Intergenic
1036296810 8:7543937-7543959 ACGTTCTCAGAACCTCCTGAGGG - Intergenic
1036325757 8:7777082-7777104 ACGTTCTCAGAACCTCCTGAGGG + Intergenic
1036327334 8:7791628-7791650 ATGTTCTGAGGACCTCCTGAGGG + Intergenic
1036390814 8:8322931-8322953 ATGGTCTCAGGATCTCCTGAGGG + Intronic
1036423200 8:8617197-8617219 ATGTTCTCAGGACCTGCTCAGGG + Intergenic
1036455629 8:8904182-8904204 GTGTTCTCAGGACTTCCTGAGGG + Intergenic
1036494708 8:9259682-9259704 ACGTTCTCAGGATCTCCTGAGGG + Intergenic
1036525346 8:9529546-9529568 ATGTTCTCAGGATCTCCTAAGGG + Intergenic
1036637673 8:10563199-10563221 ATGTTCTCAGAACCTCCTGAGGG + Intergenic
1037331766 8:17749851-17749873 ATCTTCTCAGGATCTCCTAAGGG + Intronic
1037543758 8:19897789-19897811 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1038739123 8:30201193-30201215 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1038905571 8:31898198-31898220 ATGTTCTTAAGATCTCTTGAGGG + Intronic
1038988541 8:32840571-32840593 ATGTTCTCAGGACCTCCCGATGG - Intergenic
1039069439 8:33636234-33636256 TTGGTCCCAGGGTATCCTGAAGG + Intergenic
1039301235 8:36210826-36210848 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1039354349 8:36798859-36798881 ATGTTCTCAGGATCCCCTGAGGG + Intronic
1039757424 8:40538467-40538489 ATGTTCTCAGGACCTCCTGAAGG + Intronic
1039813660 8:41072850-41072872 ATGTTCTCAGGCCCTCCTGAAGG - Intergenic
1039814543 8:41081493-41081515 AGGTACTCAGGACCTCCTGAAGG - Intergenic
1040020788 8:42739212-42739234 ATGTCCTCAGGATCTCCTGAGGG - Intergenic
1040055617 8:43055095-43055117 ATGTTCTCAGGATCTCTTAAGGG - Intronic
1040664647 8:49618471-49618493 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1040838893 8:51762745-51762767 ATGTTCTCAGGACCTCCCGAGGG + Intronic
1040853137 8:51922882-51922904 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1040921896 8:52629948-52629970 ATGTTCTCAGGGGCTCCTGAGGG + Intronic
1040997935 8:53420551-53420573 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1041317695 8:56581654-56581676 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1041320511 8:56607573-56607595 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1041359695 8:57040325-57040347 ATGTGCTCAGGACCTCCTGAAGG - Intergenic
1041609375 8:59826717-59826739 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1041741983 8:61165746-61165768 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1041767512 8:61434455-61434477 ATGTTCTTAGGACTTCCTGAGGG - Intronic
1042199847 8:66270750-66270772 ATGTTCTCAGGATCTCCTTAGGG - Intergenic
1042317081 8:67435910-67435932 ATGGTCTCAGGGCCCCCTTAGGG + Intronic
1042357576 8:67845915-67845937 ATGTCATCAGGACCTCCTGAAGG + Intergenic
1042520054 8:69701770-69701792 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1043535339 8:81196961-81196983 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1043544561 8:81300788-81300810 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
1043596739 8:81896386-81896408 ATGTTCTCAGGACCTCGTGAGGG + Intergenic
1043740787 8:83808792-83808814 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1043947868 8:86274810-86274832 ATGTTCTCAGGATCTCCTGTGGG - Intronic
1043948611 8:86282523-86282545 ATGTTCTCAGGATCTTCTGAGGG - Intronic
1043983820 8:86670839-86670861 ATTTTCTCAGGGTCTGCTTTTGG + Intronic
1044012597 8:87012925-87012947 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1044013338 8:87021161-87021183 GTGTTCTCAAGACCTCCTGACGG + Intronic
1044019251 8:87083979-87084001 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1044045726 8:87429550-87429572 ATGTTTTCAGTGTTTCCTTATGG + Intronic
1044149242 8:88753186-88753208 GTGTTCTCAGTGTCTTCAGAAGG - Intergenic
1044645552 8:94439539-94439561 ATGTTCTTAGGGCCACCTGAGGG - Intronic
1044694342 8:94907833-94907855 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1044976212 8:97668415-97668437 ATGTTCCCAGGATCTCCTGAGGG + Intronic
1045331977 8:101163003-101163025 GGGTTCTCAGAGTCTCCAGAGGG - Intergenic
1045437976 8:102183671-102183693 ATCTTCTCAGTGTGCCCTGATGG + Intergenic
1045439229 8:102193276-102193298 ATGGTCTCACTGTCTTCTGATGG + Intergenic
1045556746 8:103221875-103221897 ATACTCTCAGGATCTCCTGAGGG - Intronic
1045556984 8:103224273-103224295 ATGTTCTCGGGACCTCCTGAGGG - Intronic
1045660635 8:104433999-104434021 ATGTTCTCAAGATCTCCTGAGGG - Intronic
1046006341 8:108490714-108490736 ATGTTCTCAGGATCTCTTGAGGG - Intergenic
1046133309 8:109994893-109994915 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1046184696 8:110697357-110697379 ATATTCTCAGGATCTCCCGAGGG + Intergenic
1047135132 8:122069464-122069486 ATGTTCTCAGGATTTCCTGAGGG - Intergenic
1047241066 8:123088576-123088598 ATGTTCTCAGGCTCTCCTGAGGG - Intronic
1047963055 8:130024818-130024840 CTGTTCTTAAGCTCTCCTGAGGG - Intergenic
1048671420 8:136727408-136727430 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
1048777939 8:137968101-137968123 ATGTTCTCAGGGTCTACTGAGGG + Intergenic
1048891810 8:138955020-138955042 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1049007657 8:139865865-139865887 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1049128988 8:140820032-140820054 CTCTTCTCAAAGTCTCCTGAGGG - Intronic
1049454361 8:142679494-142679516 ATGTTCTCAGGGTCTCCTGGGGG - Intronic
1049467664 8:142759521-142759543 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1049964396 9:765347-765369 ATGTTTTCAGGACCTCCTGGGGG + Intergenic
1050044100 9:1525655-1525677 ATGTTCTCAGGGTCTCCTGAGGG + Intergenic
1050060750 9:1707189-1707211 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1050118324 9:2283060-2283082 ATGTTCTCAGTACCGCCTGAGGG - Intergenic
1050495765 9:6240189-6240211 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1050587443 9:7127380-7127402 TTGTTCTCAGGATATTCTGAAGG - Intergenic
1050636676 9:7619899-7619921 ATGTTCTCAGGACCTCCTGATGG - Intergenic
1050747801 9:8897653-8897675 ATGCTTTCAGGGTACCCTGATGG + Intronic
1050806559 9:9687399-9687421 TGTTTCTCAGGGTTTCCTGATGG + Intronic
1050944170 9:11497684-11497706 ATGTTCTGAGGATCTCATGAGGG - Intergenic
1050984428 9:12064274-12064296 ACATTCTCAGGACCTCCTGAGGG - Intergenic
1051050562 9:12927571-12927593 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1051065704 9:13099683-13099705 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1051270989 9:15354680-15354702 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1051271205 9:15356543-15356565 ATGTTCTCAGGACCTCCTGATGG + Intergenic
1051272782 9:15371543-15371565 ATGTTCTCAGGATCTCATGAGGG + Intergenic
1051343354 9:16130806-16130828 ATGTTCTTAAGGTCTTCTGAGGG - Intergenic
1051478456 9:17534264-17534286 ATGTTCTCAGCCTTTCCTCACGG + Intergenic
1052121976 9:24729376-24729398 ACGTTCTCAGGACCTCCTGAGGG + Intergenic
1052230924 9:26151827-26151849 ATGTTCTCAGGATCACCTGGAGG + Intergenic
1052560354 9:30077044-30077066 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1052563509 9:30116694-30116716 ATATTCTCAGGATTTCCTGAGGG - Intergenic
1052643956 9:31208057-31208079 ATCTTCTCAGAGCCTCCAGAAGG - Intergenic
1053078835 9:35157339-35157361 ATGTTCTCAAGACCTCCTGAGGG + Intergenic
1053241055 9:36495966-36495988 CAGGTCTCAGGATCTCCTGAGGG + Intergenic
1053594311 9:39544412-39544434 ATGTTCTCGGGATCTCCTGAGGG + Intergenic
1053799653 9:41756310-41756332 ATGTTCTCAGGACCTCCCGGGGG + Intergenic
1053852092 9:42299456-42299478 ATGTTCTCGGGATCTCCTGAGGG + Intergenic
1054188062 9:61968365-61968387 ATGTTCTCAGGACCTCCCGGGGG + Intergenic
1054571942 9:66820546-66820568 ATGTTCTCGGGATCTCCTGAGGG - Intergenic
1054650454 9:67620211-67620233 ATGTTCTCAGGACCTCCCGGGGG - Intergenic
1054858024 9:69922112-69922134 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1055449476 9:76417994-76418016 ATGTTCTCAGGGTCTTCTGAGGG - Intergenic
1055700581 9:78940731-78940753 GTTTTCTCAGGGACTCCTAAAGG - Intergenic
1055708611 9:79035159-79035181 ATGTTCTCAGGATCTTCTGAGGG - Intergenic
1056136913 9:83639450-83639472 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1056208778 9:84344931-84344953 ATGTTCTTAGGGCCTCCCAAGGG + Intergenic
1056289260 9:85126256-85126278 ATGCTCTCAGGATCTCCTGAGGG + Intergenic
1056390956 9:86141106-86141128 AAGTTTTCAGGGTTTCCTTATGG + Intergenic
1056591093 9:87966733-87966755 ATGTGCAGAGGGTCTCCTGCTGG + Exonic
1056635666 9:88329329-88329351 ACGCTCTCAGGGTCTCCTAAGGG - Intergenic
1056802791 9:89705211-89705233 AAGTTCTCAGGATCTCCTGAGGG - Intergenic
1056876062 9:90331796-90331818 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1056891746 9:90500856-90500878 ATGCTCTCAGGATCTCCTGAGGG - Intergenic
1056920073 9:90779678-90779700 AAGTCCTCAGGATGTCCTGAGGG - Intergenic
1056921228 9:90790973-90790995 ATGTTCTCAGGATCTCCTGAAGG - Intergenic
1056955717 9:91079463-91079485 ATGTTCTCAGAACCTCCTGAGGG + Intergenic
1057292943 9:93818746-93818768 ATGTTCTCATGTTCTACTCAGGG - Intergenic
1057348774 9:94276981-94277003 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1058125458 9:101189097-101189119 ATGTTCTGAGGGTCTCCTGCAGG - Intronic
1058375937 9:104321474-104321496 CTGTGCTCAGGGTATCCTTATGG + Intergenic
1058432873 9:104934486-104934508 ATGTTCTTAGGATCTCCTGAGGG - Intergenic
1058638908 9:107064163-107064185 ATGTTCTTAGGATCTCCTGAGGG + Intergenic
1059523686 9:114968504-114968526 ATATTCTCAGGACCTCCTGAGGG + Intergenic
1059546679 9:115183024-115183046 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1059707092 9:116835680-116835702 ATGTTTTCAGGACCTTCTGAGGG + Intronic
1060061907 9:120468128-120468150 CTGTGCACAGGGTATCCTGAGGG - Intronic
1061439408 9:130590065-130590087 GTGTTCTCAGGATCTCCTTGGGG - Intronic
1061496213 9:130976048-130976070 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1061736986 9:132668522-132668544 ATGTTCTCAGGACCTCTCGAGGG - Intronic
1062178016 9:135175125-135175147 ATGTTCTCAGGGCTTCCTGGTGG + Intergenic
1062258474 9:135643723-135643745 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1062258841 9:135647257-135647279 ATGTTCTCAGGCCCTCCTGAGGG + Intergenic
1062374743 9:136256826-136256848 TTGGTCTGAGGGTCTCCTGGAGG + Intergenic
1062492204 9:136811156-136811178 ATGTCCTCAGGGTCACCTGAGGG - Intronic
1062747815 9:138226670-138226692 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
1203459141 Un_GL000220v1:17722-17744 ATGTTCTCATGCTCTCCTCTAGG + Intergenic
1203583114 Un_KI270746v1:33154-33176 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1203605517 Un_KI270748v1:54629-54651 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1185712243 X:2313764-2313786 ATGTTCTCGGGATCTCCTGAGGG - Intronic
1185760879 X:2689593-2689615 ACGTTCTCGGGACCTCCTGAGGG + Intergenic
1185788761 X:2912484-2912506 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1185792998 X:2941791-2941813 ACGTTCTCGGGACCTCCTGAGGG + Intronic
1185805290 X:3051311-3051333 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1185894406 X:3844526-3844548 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1185899524 X:3882950-3882972 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1185904640 X:3921379-3921401 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1185908963 X:3965014-3965036 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1185975102 X:4711362-4711384 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1185983382 X:4804250-4804272 ATGTTCTCAGGACATCCTGAGGG - Intergenic
1186012935 X:5157052-5157074 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1186152779 X:6692852-6692874 ATGTTCTCAGGTCCTCCTGAAGG - Intergenic
1186176306 X:6929270-6929292 TTGTTCTCAGGATCTACTGAGGG - Intergenic
1186328474 X:8506719-8506741 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1186329769 X:8519487-8519509 GTGTTCTCAGGGTCTCCGGAGGG + Intergenic
1186428809 X:9486727-9486749 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1186440265 X:9580075-9580097 ATGTACTCAGGATCTCCTGAGGG - Intronic
1186691165 X:11977568-11977590 ATGTTCTCAGGACCGCCTAAGGG - Intergenic
1186935476 X:14446064-14446086 ATGATCTCTGGGAATCCTGAGGG + Intergenic
1187057306 X:15753127-15753149 ATGTTCTCAGGTCCTCCTGTGGG + Intronic
1187219611 X:17310779-17310801 ATGGACTCAGGGACTCCTAATGG + Intergenic
1187324660 X:18275174-18275196 ATGTTCTCAGGATCTCCTGGGGG + Intronic
1187806793 X:23129352-23129374 GTGTCCTCAGGACCTCCTGAGGG + Intergenic
1188155967 X:26744239-26744261 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1188390323 X:29611544-29611566 ATGTTCTCAGGACTTCCTGAGGG + Intronic
1188439659 X:30202833-30202855 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1188803832 X:34562962-34562984 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1188841417 X:35022592-35022614 ATCTTCTCAGGACCTCCTGAGGG - Intergenic
1188875967 X:35430662-35430684 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1188876065 X:35431593-35431615 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1188876781 X:35440445-35440467 ATGTTCTTAGGATCTCCTGAAGG + Intergenic
1188884834 X:35536951-35536973 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1188898146 X:35695290-35695312 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1188902708 X:35753697-35753719 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1189028238 X:37421692-37421714 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1189081020 X:37972652-37972674 ATGTTCTCAGGAGCTCCTGAGGG - Intronic
1189750257 X:44213395-44213417 ATGTTCTCAGGATCTCCTGGGGG - Intronic
1189784479 X:44547181-44547203 ATGTTCTCAGGACCTCCCGAGGG - Intergenic
1189829713 X:44958642-44958664 ATGTTCTCAGGATCTCCTGAGGG - Intronic
1190185543 X:48230774-48230796 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1190360396 X:49643843-49643865 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1190371888 X:49750634-49750656 ATGTTCTCAAGACCTTCTGAGGG - Intergenic
1190408281 X:50109587-50109609 ATGTTGTCAGGATCTCCTGAGGG + Intergenic
1190498267 X:51048865-51048887 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1190569825 X:51769814-51769836 ATGTTCTTAGGACCTCTTGAGGG + Intergenic
1190570648 X:51778290-51778312 ATGTTCTTAGGACTTCCTGAGGG + Intergenic
1190810775 X:53881314-53881336 ATGTTCTCAGGGCCTCCTGAGGG + Intergenic
1190818011 X:53945634-53945656 ATATTCTCAGCTTCTCCAGACGG + Intronic
1191021546 X:55866256-55866278 ATGTTCTCAGGACTTCCTGAGGG - Intergenic
1191088890 X:56598821-56598843 ATGTTCTCAGGCCCTCCTGTGGG + Intergenic
1191127702 X:56975177-56975199 ATGTTCTCAGGATATCCTGAGGG - Intergenic
1191190951 X:57666633-57666655 ATGTTTCCAGGACCTCCTGAGGG + Intergenic
1191201756 X:57790685-57790707 ATGTCCTCAGGACCTCCTGAGGG + Intergenic
1191624455 X:63255365-63255387 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1191625980 X:63271956-63271978 CTGTTCTTAGGACCTCCTGAGGG - Intergenic
1191638268 X:63401584-63401606 ATGTTCTCAGGGCCTCCTGAGGG + Intergenic
1191639831 X:63418096-63418118 ACGTTCTCAGGAGCTCCTAAAGG - Intergenic
1191642536 X:63442813-63442835 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1192087544 X:68115844-68115866 AAGTTCTCAGGACCTCCTGAGGG - Intronic
1192283254 X:69706487-69706509 ATATTCTCAGGATCTCCTGAGGG - Intronic
1192579167 X:72266738-72266760 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1192703931 X:73508682-73508704 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1192728929 X:73782800-73782822 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1192802881 X:74484185-74484207 ATGTTCTCAAGACCTTCTGAGGG - Intronic
1192803583 X:74491182-74491204 ATGTTCTCAAGACCTTCTGAGGG - Intronic
1193283872 X:79688851-79688873 ATGTTCTCAGAATCTCCTGAGGG - Intergenic
1193324052 X:80158456-80158478 GTGTTCTCAGGGGATCCTCATGG - Intergenic
1193372619 X:80714642-80714664 AGAGTCTCAGGATCTCCTGAGGG + Intronic
1193416224 X:81228177-81228199 ATGTTTTCATGATCTCCTGAAGG - Intronic
1193484987 X:82076727-82076749 ATGTCCTCCGGATCTCCTGAGGG - Intergenic
1193486662 X:82092064-82092086 ACATTCTCAGGATCTCCTGAGGG - Intergenic
1193532374 X:82671351-82671373 ATATTCTCAGGATTTCCTGAGGG - Intergenic
1193696217 X:84709768-84709790 ATGTTGTCAGGGTCTCATGAGGG - Intergenic
1193708705 X:84855020-84855042 GTGTTCTCAGGACCTCCTGAGGG - Intergenic
1193710567 X:84873870-84873892 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
1193718292 X:84957744-84957766 GTGTTCTCAGGACCTCCTGAGGG - Intergenic
1193809602 X:86036160-86036182 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1193974749 X:88103313-88103335 ATGTTCTCAGGATGTCTTGAAGG + Intergenic
1194010791 X:88558623-88558645 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1194014896 X:88606746-88606768 ATGGTCTCAGGATCTCCTGAGGG + Intergenic
1194014951 X:88607888-88607910 ATACTCTCAGGATTTCCTGATGG - Intergenic
1194089315 X:89565648-89565670 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1194092317 X:89593003-89593025 ATGTTCTTACAGTCTCCTGAAGG + Intergenic
1194104580 X:89753128-89753150 ATATTCTCAGGGTCTCCTAAGGG - Intergenic
1194130795 X:90079436-90079458 ATGTTCTCAGCTTCTCTTGAGGG + Intergenic
1194132041 X:90093235-90093257 ATGTTCTCAGACTCTCCTGAAGG + Intergenic
1194138881 X:90182567-90182589 ATGTTCTCAGGGCCTCCTGAGGG + Intergenic
1194150277 X:90316437-90316459 ATAATCTCAGGATCTCCTGAGGG + Intergenic
1194204885 X:91001352-91001374 ATGTTCTCAGGACCTACTGAGGG + Intergenic
1194205941 X:91011055-91011077 ATGTTTTCAGGACCTCCTGAGGG + Intergenic
1194256649 X:91643502-91643524 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1194289212 X:92048794-92048816 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1194294166 X:92107790-92107812 ATGTTCTCAGGACTTCCTGAGGG + Intronic
1194341664 X:92713196-92713218 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1194480112 X:94411500-94411522 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1194485907 X:94485976-94485998 ATGTTCTTAGGACCTCCTGAGGG - Intergenic
1194488625 X:94518552-94518574 ATGTATTAAGGTTCTCCTGAGGG + Intergenic
1194824101 X:98540578-98540600 ATGTTCTCACGATCTCCTGAGGG - Intergenic
1195146279 X:102020166-102020188 ATGTTCTCAGGACCTTCTGAGGG + Intergenic
1195256507 X:103096181-103096203 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1195493100 X:105496287-105496309 ATGTTCTCAGGATTTCCTGAGGG + Intronic
1195546381 X:106116826-106116848 ATGTTTTCAGGACATCCTGAGGG - Intergenic
1195547004 X:106123977-106123999 ACGTTCTCAGGACCTCCTGAGGG - Intergenic
1195565641 X:106336294-106336316 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1195566537 X:106345695-106345717 ATGTTCTCAGGATCTCCTGAGGG - Intergenic
1195759157 X:108227404-108227426 ATGTTCTCAGGATCTCCCAAGGG - Intronic
1196051719 X:111312804-111312826 ATGTTCTTAGTGTCTTCTGAGGG - Intronic
1196072545 X:111542658-111542680 ATGTTCTCAGGACCTCCTGATGG - Intergenic
1196287339 X:113897956-113897978 ATGTTCTCAGGGTCTCCTGAGGG - Intergenic
1196301953 X:114058113-114058135 TTGTTCTCAGGACCTCCTGAGGG + Intergenic
1197081561 X:122424636-122424658 ATGTTATATGAGTCTCCTGAAGG + Intergenic
1197351252 X:125386330-125386352 AGCTTCTCAGGCTCTCCTGAGGG - Intergenic
1197352511 X:125395459-125395481 ATGTTCTCAGGACCATCTGAGGG - Intergenic
1197479391 X:126963466-126963488 ATATTCTCAGGACCTCCTGAGGG + Intergenic
1197616135 X:128693777-128693799 ATGTTATCAGGGTTTCTTTATGG - Intergenic
1198048095 X:132922610-132922632 ATGGTCTCAAGACCTCCTGAGGG - Intronic
1198123680 X:133620984-133621006 ACATTCTCAGGATCCCCTGAGGG + Intronic
1198258515 X:134946007-134946029 ATGTTCTCAGGATCTCCTGGGGG + Intergenic
1198434868 X:136607418-136607440 ATGTTCTCAGGACCTCCTGAAGG - Intergenic
1198982901 X:142419424-142419446 ATGTTCTCAGGGTCTCCTGTGGG + Intergenic
1199171498 X:144739404-144739426 GTGTTCTCAGGACCTCCTGAGGG + Intergenic
1199336802 X:146628013-146628035 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1199357831 X:146882112-146882134 ATGTTCTCTGGACCTCCTGAGGG - Intergenic
1199367449 X:147003444-147003466 ATGTTCTCAGGATCTCCTGAGGG + Intergenic
1199380997 X:147172546-147172568 ATGTTCTCAAGATCTCTTGAGGG - Intergenic
1200293402 X:154893278-154893300 ATGTTCTCAGGATCTCCTGAGGG + Intronic
1200293504 X:154894223-154894245 ATGTTCTCAGGACCTCCTGAGGG + Intronic
1200392686 X:155959753-155959775 ATGTTCTCAGGACCTCCTAAGGG - Intergenic
1200425201 Y:3012919-3012941 ATGTTCTCAGAACCTCTTGAGGG - Intergenic
1200441976 Y:3221696-3221718 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1200456536 Y:3400907-3400929 ATATTCTCAGGGTCTCCTAAGGG - Intergenic
1200484684 Y:3752800-3752822 ATGTTCTCAGGGCCTCCTGAGGG + Intergenic
1200496640 Y:3893194-3893216 ATAATCTCAGGATCTCCTGAGGG + Intergenic
1200550712 Y:4576497-4576519 ATGTTCTCAGGACCTACTGAGGG + Intergenic
1200551697 Y:4585863-4585885 ATGTTTTCAGGACCTCCTGAGGG + Intergenic
1200575366 Y:4882764-4882786 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1200584082 Y:4985894-4985916 ATGTTCTCAGAATCTCCTAGGGG + Intergenic
1200606728 Y:5273368-5273390 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1200611674 Y:5332310-5332332 ACGTTCTCAGGACTTCCTGAGGG + Intronic
1200650012 Y:5829894-5829916 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1200660271 Y:5948409-5948431 ATGTTCTCAGGACCTCCTGAGGG + Intergenic
1200813712 Y:7509976-7509998 ATGATCTCAGGAGATCCTGAGGG + Intergenic
1200908729 Y:8512821-8512843 ATCTGCTCTGGGACTCCTGAGGG + Intergenic
1201236171 Y:11914175-11914197 ATGTCATCAGGACCTCCTGAGGG - Intergenic
1201263976 Y:12188102-12188124 ATGTCCTCAAGCTCTCCTGAGGG + Intergenic
1201280116 Y:12335295-12335317 ATGTCTTCAGGACCTCCTGAGGG - Intergenic
1201286174 Y:12380633-12380655 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1201319057 Y:12677366-12677388 ATGTTCTCAGAATCTCCTGAGGG - Intergenic
1201328879 Y:12797258-12797280 ATGTTCTCAGGACCTCCTGAGGG - Intronic
1201403367 Y:13627253-13627275 GTATTCTTAGGGTCTTCTGAGGG + Intergenic
1201433833 Y:13934201-13934223 ATGTTCTTAGGACCTCCTGAGGG + Intergenic
1201472262 Y:14346450-14346472 ATGTTCTCAGGACCTACTTAGGG + Intergenic
1201630400 Y:16065359-16065381 ATATTCTCAGGGTATCCTAAGGG - Intergenic
1201725353 Y:17144356-17144378 ATGTTCTCAGGACCTTCTGAGGG - Intergenic
1201891073 Y:18944837-18944859 ATGTTCTCAGGACTTCCTGAGGG - Intergenic
1202063100 Y:20908836-20908858 ATGTTCTCAGTGTCTGCTGGAGG - Intergenic
1202068018 Y:20960661-20960683 ATGTTCTCAGGACCCCCTGAGGG - Intergenic
1202387699 Y:24341070-24341092 ATGTTCTCAGGACCTCCTGAGGG - Intergenic
1202483087 Y:25329058-25329080 ATGTTCTCAGGACCTCCTGAGGG + Intergenic