ID: 961345057

View in Genome Browser
Species Human (GRCh38)
Location 3:126258886-126258908
Sequence CTTGCCTGAGGCCACCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961345057_961345062 28 Left 961345057 3:126258886-126258908 CCTGTGTGGTGGCCTCAGGCAAG No data
Right 961345062 3:126258937-126258959 ACAACTGCTCAGATGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961345057 Original CRISPR CTTGCCTGAGGCCACCACAC AGG (reversed) Intergenic