ID: 961345060

View in Genome Browser
Species Human (GRCh38)
Location 3:126258909-126258931
Sequence TGTGAATCTGTCCTGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961345060_961345062 5 Left 961345060 3:126258909-126258931 CCCTTCTGCAGGACAGATTCACA No data
Right 961345062 3:126258937-126258959 ACAACTGCTCAGATGCTCAGAGG No data
961345060_961345063 10 Left 961345060 3:126258909-126258931 CCCTTCTGCAGGACAGATTCACA No data
Right 961345063 3:126258942-126258964 TGCTCAGATGCTCAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961345060 Original CRISPR TGTGAATCTGTCCTGCAGAA GGG (reversed) Intergenic