ID: 961345061

View in Genome Browser
Species Human (GRCh38)
Location 3:126258910-126258932
Sequence CTGTGAATCTGTCCTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961345061_961345065 30 Left 961345061 3:126258910-126258932 CCTTCTGCAGGACAGATTCACAG No data
Right 961345065 3:126258963-126258985 GGCAGCTGCACTTCCTGTGATGG No data
961345061_961345063 9 Left 961345061 3:126258910-126258932 CCTTCTGCAGGACAGATTCACAG No data
Right 961345063 3:126258942-126258964 TGCTCAGATGCTCAGAGGCCAGG No data
961345061_961345062 4 Left 961345061 3:126258910-126258932 CCTTCTGCAGGACAGATTCACAG No data
Right 961345062 3:126258937-126258959 ACAACTGCTCAGATGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961345061 Original CRISPR CTGTGAATCTGTCCTGCAGA AGG (reversed) Intergenic