ID: 961345062

View in Genome Browser
Species Human (GRCh38)
Location 3:126258937-126258959
Sequence ACAACTGCTCAGATGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961345061_961345062 4 Left 961345061 3:126258910-126258932 CCTTCTGCAGGACAGATTCACAG No data
Right 961345062 3:126258937-126258959 ACAACTGCTCAGATGCTCAGAGG No data
961345057_961345062 28 Left 961345057 3:126258886-126258908 CCTGTGTGGTGGCCTCAGGCAAG No data
Right 961345062 3:126258937-126258959 ACAACTGCTCAGATGCTCAGAGG No data
961345058_961345062 16 Left 961345058 3:126258898-126258920 CCTCAGGCAAGCCCTTCTGCAGG No data
Right 961345062 3:126258937-126258959 ACAACTGCTCAGATGCTCAGAGG No data
961345060_961345062 5 Left 961345060 3:126258909-126258931 CCCTTCTGCAGGACAGATTCACA No data
Right 961345062 3:126258937-126258959 ACAACTGCTCAGATGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961345062 Original CRISPR ACAACTGCTCAGATGCTCAG AGG Intergenic