ID: 961345063

View in Genome Browser
Species Human (GRCh38)
Location 3:126258942-126258964
Sequence TGCTCAGATGCTCAGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961345061_961345063 9 Left 961345061 3:126258910-126258932 CCTTCTGCAGGACAGATTCACAG No data
Right 961345063 3:126258942-126258964 TGCTCAGATGCTCAGAGGCCAGG No data
961345058_961345063 21 Left 961345058 3:126258898-126258920 CCTCAGGCAAGCCCTTCTGCAGG No data
Right 961345063 3:126258942-126258964 TGCTCAGATGCTCAGAGGCCAGG No data
961345060_961345063 10 Left 961345060 3:126258909-126258931 CCCTTCTGCAGGACAGATTCACA No data
Right 961345063 3:126258942-126258964 TGCTCAGATGCTCAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961345063 Original CRISPR TGCTCAGATGCTCAGAGGCC AGG Intergenic