ID: 961347537

View in Genome Browser
Species Human (GRCh38)
Location 3:126273955-126273977
Sequence TCTAGGGGCCCTCGCCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961347532_961347537 -8 Left 961347532 3:126273940-126273962 CCTAGGAGGGTCACCTCTAGGGG No data
Right 961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG No data
961347523_961347537 20 Left 961347523 3:126273912-126273934 CCCTTTTACCCTCTGATCTGCTC No data
Right 961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG No data
961347521_961347537 25 Left 961347521 3:126273907-126273929 CCAACCCCTTTTACCCTCTGATC No data
Right 961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG No data
961347522_961347537 21 Left 961347522 3:126273911-126273933 CCCCTTTTACCCTCTGATCTGCT No data
Right 961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG No data
961347526_961347537 11 Left 961347526 3:126273921-126273943 CCTCTGATCTGCTCAGTGTCCTA No data
Right 961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG No data
961347524_961347537 19 Left 961347524 3:126273913-126273935 CCTTTTACCCTCTGATCTGCTCA No data
Right 961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG No data
961347525_961347537 12 Left 961347525 3:126273920-126273942 CCCTCTGATCTGCTCAGTGTCCT No data
Right 961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961347537 Original CRISPR TCTAGGGGCCCTCGCCCTTG GGG Intergenic
No off target data available for this crispr