ID: 961351743

View in Genome Browser
Species Human (GRCh38)
Location 3:126308535-126308557
Sequence CAAGTGCGACCCTGGCGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961351735_961351743 25 Left 961351735 3:126308487-126308509 CCGGTGTCTGCCGCAGGCAGTGC No data
Right 961351743 3:126308535-126308557 CAAGTGCGACCCTGGCGCTCGGG No data
961351734_961351743 26 Left 961351734 3:126308486-126308508 CCCGGTGTCTGCCGCAGGCAGTG No data
Right 961351743 3:126308535-126308557 CAAGTGCGACCCTGGCGCTCGGG No data
961351736_961351743 15 Left 961351736 3:126308497-126308519 CCGCAGGCAGTGCTGACACAGAG No data
Right 961351743 3:126308535-126308557 CAAGTGCGACCCTGGCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961351743 Original CRISPR CAAGTGCGACCCTGGCGCTC GGG Intergenic
No off target data available for this crispr