ID: 961355999

View in Genome Browser
Species Human (GRCh38)
Location 3:126340382-126340404
Sequence GCCCCTTGGCTCCACAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961355999_961356004 2 Left 961355999 3:126340382-126340404 CCAGTCCTGTGGAGCCAAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 187
Right 961356004 3:126340407-126340429 TGGAGGAGCAACAAGAGCGAAGG 0: 1
1: 0
2: 2
3: 25
4: 294
961355999_961356005 5 Left 961355999 3:126340382-126340404 CCAGTCCTGTGGAGCCAAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 187
Right 961356005 3:126340410-126340432 AGGAGCAACAAGAGCGAAGGAGG 0: 1
1: 0
2: 0
3: 37
4: 389
961355999_961356007 10 Left 961355999 3:126340382-126340404 CCAGTCCTGTGGAGCCAAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 187
Right 961356007 3:126340415-126340437 CAACAAGAGCGAAGGAGGCTGGG 0: 1
1: 0
2: 4
3: 46
4: 364
961355999_961356006 9 Left 961355999 3:126340382-126340404 CCAGTCCTGTGGAGCCAAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 187
Right 961356006 3:126340414-126340436 GCAACAAGAGCGAAGGAGGCTGG 0: 1
1: 0
2: 2
3: 31
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961355999 Original CRISPR GCCCCTTGGCTCCACAGGAC TGG (reversed) Intergenic
900748571 1:4378331-4378353 GTCCCTTGTCTCAGCAGGACTGG + Intergenic
901022715 1:6263115-6263137 GCCCCTTGGCCCCCCGGGGCTGG - Intergenic
901781601 1:11598160-11598182 GCCCCCTGGTTCCCCAGAACTGG - Intergenic
902510316 1:16963351-16963373 GCCCCTGCTGTCCACAGGACAGG - Intronic
903143651 1:21355815-21355837 CCCACTTGGCTCCACAGCCCTGG - Intergenic
904051939 1:27645203-27645225 GACCCATGGAGCCACAGGACAGG + Intergenic
904264323 1:29309778-29309800 GCCCCTGGGCTCCTCAGGCCTGG + Intronic
905305542 1:37015430-37015452 GCCACCTGGCTCCAAAGGGCTGG + Intronic
909133653 1:71769685-71769707 GACTCATGGTTCCACAGGACTGG - Intronic
910090146 1:83452324-83452346 ATCCCTTGGTTCCACATGACAGG - Intergenic
912721075 1:112020696-112020718 TCTCCTGGGCTCCACTGGACCGG + Intergenic
920698917 1:208203176-208203198 GCCTCTTGGGTCCCCAGAACTGG - Intronic
923151999 1:231241561-231241583 GCCCCTAGGCTCCCGAGGAGGGG + Intronic
1062853091 10:760184-760206 CCCCCTTGGGTCCCAAGGACAGG + Intergenic
1063164217 10:3445132-3445154 GCCACTTGGCTACAAAGGATGGG + Intergenic
1066087297 10:31983429-31983451 GCACCTTGGCACCCCAGGCCTGG + Intergenic
1067375003 10:45719860-45719882 GCCCCTTGCCCCCACTGAACAGG + Intergenic
1067378724 10:45752661-45752683 GCCCCTTGCCGCCACTGAACAGG - Exonic
1067882817 10:50061501-50061523 GCCCCTTGCCCCCACTGAACAGG + Intergenic
1067886423 10:50093341-50093363 GCCCCTTGCCCCCACTGAACAGG - Exonic
1069592965 10:69653088-69653110 GCCCCTCTGGTTCACAGGACTGG - Intergenic
1073429439 10:103476713-103476735 GCCCCTGGGATCCCCAGGACTGG + Intronic
1073637389 10:105213888-105213910 GCCCAGTGGCTCCACAGAAAGGG + Intronic
1074701094 10:116093192-116093214 GCCCCTTGGATGCTCAGGGCTGG - Intronic
1075742358 10:124703640-124703662 TCCCCTTGGCTCCAGATGAGAGG - Intronic
1076063270 10:127429661-127429683 GCTCCTTGGAGCCCCAGGACTGG - Intronic
1077408957 11:2394731-2394753 GGCACCAGGCTCCACAGGACGGG - Intronic
1077437448 11:2549702-2549724 GGCCCTGGGCTCCCCAGGCCTGG + Intronic
1077541450 11:3148343-3148365 GGCCCTTGCCTCCCCAGGTCAGG - Intronic
1080088496 11:28315730-28315752 GTCCCTAGGCTGCACAGAACAGG - Intronic
1080577021 11:33609348-33609370 GCCACTGGGTTCCCCAGGACTGG + Intronic
1081826949 11:46064092-46064114 GCTTCTTGACTCCACAGGAAAGG + Intronic
1082766213 11:57169881-57169903 GTCCCTAGGCTGCACAGCACAGG + Intergenic
1084484062 11:69437920-69437942 GCCCCTTGTCTTCAAAGGAAGGG - Intergenic
1084526370 11:69700904-69700926 ACCCCTTGGCGACCCAGGACAGG + Intronic
1086912633 11:92490796-92490818 GCCCCTTTCCTCCAGAAGACTGG - Intronic
1089457370 11:118633508-118633530 ACTCCTTGGCTCCAGAGGGCAGG - Intronic
1098917455 12:76272318-76272340 GCCCCTGGGAACCTCAGGACAGG + Intergenic
1102510990 12:113415311-113415333 GCCCCATGCCTGCACAGCACGGG - Intronic
1103130916 12:118467708-118467730 ACAACTTGGCTCCACAAGACTGG - Intergenic
1103536388 12:121636547-121636569 TCCACTTGGCTCCACAGCCCGGG - Intronic
1104786794 12:131455456-131455478 GCCCCATGGCTGCTCTGGACAGG + Intergenic
1104844772 12:131841262-131841284 GACCCCTGGCCCCACAAGACGGG - Intronic
1105014974 12:132781128-132781150 GCCCCACGGCTCCAGAGGCCAGG + Intronic
1110730883 13:78877286-78877308 GCCCCCTGGCCCCACAGGCTTGG - Intergenic
1112379402 13:98874155-98874177 GCCCCGTGGTTGCCCAGGACTGG - Intronic
1113888299 13:113723030-113723052 CACCCCTGGCTGCACAGGACAGG - Intronic
1117226604 14:53667200-53667222 TCCCCTGGGTTCCAGAGGACAGG - Intergenic
1119130538 14:72168446-72168468 GCACATTGGCTCCAGAGCACTGG + Intronic
1121320168 14:92987496-92987518 GGCCCCTGGCTCCAGAGGACAGG + Intronic
1121718010 14:96089902-96089924 GACCCCAGGCTCCCCAGGACAGG + Exonic
1122828866 14:104385884-104385906 GCCCTTTTGATCCCCAGGACAGG + Intergenic
1122877899 14:104677297-104677319 TCCTCCTGCCTCCACAGGACGGG - Intergenic
1123060469 14:105592080-105592102 TCCACATGGCTCCACAGGGCGGG + Intergenic
1123084947 14:105713051-105713073 TCCACATGGCTCCACAGGGCGGG + Intergenic
1123990883 15:25682496-25682518 GCCACTTAATTCCACAGGACAGG + Intronic
1124139455 15:27064450-27064472 GCCCACTGGCTCCTCAGGAAAGG + Intronic
1124226205 15:27897288-27897310 GTCCCTGGGCTACACAGGGCAGG - Intronic
1125553785 15:40567642-40567664 GCCTCTTTGCTCCATAGGATTGG - Intergenic
1129608631 15:77036899-77036921 GCCCCTTGGGGACACAGGATGGG - Intronic
1129955008 15:79628235-79628257 GCCCCTGTGCCTCACAGGACAGG - Intergenic
1130445059 15:83992850-83992872 GACCCATGGCCCCACAGCACAGG - Intronic
1131621944 15:94077904-94077926 GCCCCTCGGCTCCAGCAGACTGG + Intergenic
1132810372 16:1794114-1794136 GCCCCTTAGCCCCACACGGCTGG - Intronic
1134354421 16:13467704-13467726 GCCCCTTGGCTCCATCCAACAGG - Intergenic
1135252914 16:20916219-20916241 GCCCTTTGGGACCACAGAACTGG + Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1137727460 16:50666739-50666761 GCCACTGGGCTCCTCAGGAAAGG + Intronic
1138431310 16:56970977-56970999 GCTCCATGGATGCACAGGACTGG + Intronic
1139548975 16:67663095-67663117 GCCACATGGCTGCAAAGGACAGG - Exonic
1140743787 16:77963718-77963740 CTCCCGTGGCTCCACAGTACAGG + Intronic
1141604202 16:85143677-85143699 GCCCCCTTGATCCACAGGCCAGG - Intergenic
1141819165 16:86433104-86433126 ACCCCTTGGCTCCAGGGCACTGG - Intergenic
1141895343 16:86955497-86955519 GCCCCTGGCCTCCAAAGGAAAGG + Intergenic
1142685176 17:1573433-1573455 GCTCCGTGGCTCCTCAGGAGCGG - Intronic
1143509260 17:7386544-7386566 TCCTCTTGTCTCCACAGGCCGGG + Exonic
1144082976 17:11781499-11781521 GCACCATGGCCCCACAGCACTGG + Intronic
1144750137 17:17642750-17642772 GGCCATGAGCTCCACAGGACAGG + Intergenic
1145067538 17:19772060-19772082 GCCCAGGGGCTCCACAGGGCTGG + Intronic
1145741128 17:27275601-27275623 GCTCCTGGACTCCACAGGCCAGG - Intergenic
1145935120 17:28710899-28710921 GCTCCTCGGCCCCGCAGGACGGG - Intronic
1147948502 17:44093746-44093768 CCCCCGTAGCTCCACAGGGCTGG + Exonic
1148021302 17:44555941-44555963 GCCCCTTTGCTTCACAGTATGGG - Intergenic
1148079697 17:44960840-44960862 ACACCTTGGCCCCACAGGTCAGG + Intronic
1148678222 17:49457387-49457409 AGCCCTTGGCTCCCCAGGGCGGG - Intronic
1150471076 17:65438234-65438256 GCCCCTTCCCTCCCCAGGTCTGG - Intergenic
1150802541 17:68292827-68292849 GCCCCTTGGCTGTACACTACTGG - Intronic
1153267312 18:3284060-3284082 GCCCCTCCCCTCCACAGGGCAGG - Intergenic
1153665656 18:7365856-7365878 GACCCCCGTCTCCACAGGACAGG + Intergenic
1153928741 18:9859313-9859335 GGCCCTTGGGTCAACAGCACCGG - Exonic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1160362340 18:78294590-78294612 GCGCCATGGCTCCAGAGGAGAGG + Intergenic
1166108927 19:40611175-40611197 GCCCCTCGGCCACACAGGCCTGG - Exonic
1167097322 19:47381295-47381317 GCCCCCAGGCCCCACAGGATGGG + Exonic
1167346246 19:48947205-48947227 CCCCCTTCAGTCCACAGGACTGG - Intergenic
1167761330 19:51451600-51451622 GCCACTCGGCTACTCAGGACAGG - Exonic
925060553 2:886714-886736 GACCCTTGGCTCCTGACGACAGG - Intergenic
927472713 2:23386955-23386977 GCCGCTTGGTTCCACAGCCCAGG - Intronic
928427828 2:31193214-31193236 GCCTCCTGGCTCAACAGGCCTGG + Exonic
929506103 2:42529416-42529438 GGCCCTTGGCACCTAAGGACAGG - Intronic
932054745 2:68432862-68432884 CTCCCTTGGGTCCTCAGGACTGG + Intergenic
933308598 2:80632694-80632716 GGGTCTTGGCTCCACAGGAGAGG - Intronic
935219656 2:101001806-101001828 GCCCTGTGGCTCCACCGCACAGG + Intronic
936089638 2:109492782-109492804 GCCCTGTGACTACACAGGACTGG - Intronic
936283932 2:111166308-111166330 GCCCCTGGGCAGCACAGGGCAGG - Exonic
937011860 2:118570018-118570040 GTCCCATGGATCCACAGCACAGG - Intergenic
937095515 2:119232863-119232885 GCCCCTTGGCTCTGCAGCACAGG - Intronic
937977757 2:127592068-127592090 GCCCCTTGCCTACATAGGTCGGG - Intronic
938560174 2:132465329-132465351 GTTCCTGGGCTCCAGAGGACTGG - Intronic
942631042 2:177949497-177949519 TCCCCCTGGCTCAACAGGTCTGG - Intronic
944301322 2:198128181-198128203 TCCCCTTGTCCCCATAGGACAGG - Intronic
946113756 2:217444003-217444025 GACCCGTGGCCCCACAGGGCTGG + Intronic
946313965 2:218897536-218897558 GCCCCTTAGCTCTTCAGGCCCGG - Intronic
948913978 2:241020905-241020927 GTCCCCTGACACCACAGGACGGG + Intronic
949056726 2:241931992-241932014 GCCCCTTGGCCCCTCAGGAGGGG + Intergenic
1170698887 20:18685385-18685407 GCCAGTTGGCTGCACATGACGGG + Intronic
1175660799 20:60810344-60810366 GCCCCTGGGCCCCACTGTACAGG + Intergenic
1176085370 20:63293391-63293413 GCCCCTGTGAGCCACAGGACCGG + Intronic
1176143289 20:63554306-63554328 TCCCCTTGGCTCCCCTGGCCCGG - Exonic
1176389892 21:6158069-6158091 GCACCCTTGCTCCACAGGGCTGG - Intergenic
1178244345 21:30936558-30936580 GCCCCTTGGCTCCAGCAGCCTGG + Intergenic
1178358928 21:31932235-31932257 GCCTCTTTGCTCCACAGGGTTGG + Intronic
1178491733 21:33056912-33056934 ACCCTGAGGCTCCACAGGACAGG + Intergenic
1179733575 21:43380171-43380193 GCACCCTTGCTCCACAGGGCTGG + Intergenic
1180215179 21:46318956-46318978 GCCCCTCGGGTCCACAGGTCTGG - Intronic
1181042025 22:20196855-20196877 GCCCCTGGCCCACACAGGACCGG - Intergenic
1181677141 22:24462742-24462764 TGCCCTTGGCTCCTCAGGACTGG - Intergenic
1182900028 22:33890055-33890077 GCCCACTGGCTCCTCAGGCCTGG + Intronic
1183368755 22:37420511-37420533 GCGCCCTCGCTCCACAGGAAGGG + Intronic
1184220284 22:43095334-43095356 GACACTTGGGTCCCCAGGACTGG - Intergenic
1185192573 22:49447955-49447977 TCCCCGTGGCCCCACAGGAATGG - Intronic
950125180 3:10506108-10506130 GCCCCTTTGCCCCCCAGGTCTGG - Intronic
950305809 3:11914826-11914848 GCCCCATGGCTCCTGAGGCCCGG - Intergenic
950408879 3:12821449-12821471 GCCCCTTGGTCCCACATAACAGG - Intronic
950497165 3:13340695-13340717 CACCCCTGGCTCCACAGGCCAGG - Intronic
952123193 3:30268683-30268705 GACTCTTGGCTCACCAGGACAGG - Intergenic
952296086 3:32063389-32063411 GCTTCTTGGCTCCACAGCTCAGG + Intronic
959172553 3:102860256-102860278 GTCCCTAGGCTGCACAGAACAGG + Intergenic
960973241 3:123154090-123154112 GCTCCTGGGCTCACCAGGACAGG + Intronic
960988541 3:123295888-123295910 GCCTCTTGGCTCCAGAGTGCAGG + Intronic
961355999 3:126340382-126340404 GCCCCTTGGCTCCACAGGACTGG - Intergenic
962114321 3:132486240-132486262 GCCACATGGCCCCACAGGAAAGG - Intronic
964289141 3:155156156-155156178 ACCCCCTGACTCCACAGCACAGG - Intronic
966256109 3:177917919-177917941 CCCCCTTCAGTCCACAGGACTGG - Intergenic
967134744 3:186503832-186503854 GACCCTTAGCTCCCTAGGACTGG + Intergenic
969329249 4:6463554-6463576 GCCCCTGTGCTGCCCAGGACAGG - Intronic
971670277 4:29546876-29546898 GTCCCTAGGCTGCACAGAACAGG + Intergenic
982108038 4:152028453-152028475 ACCCTTTGGCTCCACTGGATTGG - Intergenic
983279633 4:165664354-165664376 GCCCCTTGTCTTCACAGAACAGG - Intergenic
984296557 4:177861678-177861700 GCCCCTTGCCCCCACAGGCTTGG + Intronic
985487533 5:159841-159863 GTCCCGAGACTCCACAGGACAGG - Intronic
985566379 5:620432-620454 GCCCTGTGTCTGCACAGGACAGG + Intronic
996538359 5:124602208-124602230 TCTCCTTGGCTCCTCAGCACAGG - Intergenic
996577850 5:124996220-124996242 GACCATTGGTTCCACAGGCCAGG - Intergenic
997829149 5:137134023-137134045 GCCCCATGACTCCACAGCAGAGG + Intronic
1002616919 5:180461720-180461742 GCTCCTGGGCTCCCCAGGCCAGG + Intergenic
1003706309 6:8535216-8535238 GCCCCTTGAATCCAAAGGAATGG + Intergenic
1004788556 6:18997653-18997675 GCCCCTCGTCTCCTCAGGGCTGG - Intergenic
1006738685 6:36292594-36292616 GCACCGTGGCTCCACAAGAGGGG - Intronic
1007087635 6:39160594-39160616 GCTACTTGTCTCCCCAGGACAGG + Intergenic
1017407895 6:154139590-154139612 GTCCCTGGGCTGCACAGGTCAGG - Intronic
1018907827 6:168085520-168085542 CCACCATGGCTCCCCAGGACGGG + Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019713481 7:2527891-2527913 TCCCTTTGCCTCCCCAGGACAGG + Exonic
1021798801 7:24284349-24284371 GCCCCAGGGCTCCACAGAGCGGG - Intronic
1022284256 7:28940063-28940085 CCCCCTTTGCTCCACAGGAGAGG + Intergenic
1022872799 7:34497183-34497205 GCCCCTTGGCTCCACAGTGATGG + Intergenic
1024637061 7:51299828-51299850 GACCCATGACTCCACAAGACAGG + Intronic
1024948198 7:54833169-54833191 GTCCCCTGGCTGCACAGGGCGGG - Intergenic
1026895617 7:74008400-74008422 GCCCCATGGCCTCCCAGGACCGG + Intergenic
1027306995 7:76908770-76908792 ATCCCTTGGTTCCACATGACAGG - Intergenic
1034222277 7:149455717-149455739 GCCCCCTGGCTTCCCAGGAAGGG - Exonic
1034445317 7:151111093-151111115 ACCCCTTCGCCCCCCAGGACTGG - Intronic
1036033666 8:4996427-4996449 GACCCTCTGCTCCACAGGCCCGG - Intergenic
1036137354 8:6174408-6174430 GCCTGTTGGATCCAGAGGACAGG - Intergenic
1036767606 8:11558607-11558629 CCTCCTTGGCTACCCAGGACTGG + Intronic
1043578525 8:81686165-81686187 GCCCCTTCCCTCCTCAGGAGCGG - Intronic
1047104667 8:121719860-121719882 CCCCCTTTGTTCCACAGGACTGG + Intergenic
1047595130 8:126370569-126370591 GCCCCTTTGCTCCACAACCCAGG - Intergenic
1050277809 9:4018301-4018323 TCTCCTTGGTTACACAGGACTGG + Intronic
1050778872 9:9304935-9304957 GTCACTTGGCTGCACAGGATGGG + Intronic
1052350635 9:27455272-27455294 GCCCCCTGACATCACAGGACAGG + Exonic
1056846760 9:90045005-90045027 GGCCCTTGTCTCCACTGGCCCGG - Intergenic
1057437457 9:95055598-95055620 GCCCCTTCAGTCCACAGGAATGG - Intronic
1057866790 9:98687755-98687777 GCTTACTGGCTCCACAGGACAGG + Intronic
1058149889 9:101452561-101452583 GTCCCTAGGCTGCACAGGGCAGG - Intergenic
1060995271 9:127872222-127872244 GCCCCTGAGCTCCCCAGGGCAGG - Intronic
1061008800 9:127943341-127943363 GCCCCTTTGCAACACAGGGCTGG - Intronic
1062481669 9:136755230-136755252 GCCCCTGGGCTCACCAGGCCGGG + Exonic
1062567120 9:137168317-137168339 GCCCCTTGACCCCACACGCCGGG + Exonic
1189281183 X:39821146-39821168 GCCCCGGGGCTCCCGAGGACTGG - Intergenic
1190983893 X:55483556-55483578 GACCCTTGGCTGCAAATGACAGG + Intergenic
1196368315 X:114947336-114947358 GTCCCTAGGCTGCACAGCACAGG + Intergenic
1197796027 X:130299509-130299531 GCCCCTTGGCTCTAGCGGTCTGG - Intergenic
1200081610 X:153579579-153579601 GCCACTCGTCTCCCCAGGACAGG + Intronic
1200176690 X:154122046-154122068 GACCCCTGGGTCCACAGGGCAGG - Intergenic
1200217299 X:154373679-154373701 GCCCCCTGGCTACGCAGGCCTGG - Intronic
1200237225 X:154473470-154473492 CCGCCTTGGCCCCACAGGGCGGG - Exonic
1201149216 Y:11086328-11086350 GCCCCCAGGTACCACAGGACAGG - Intergenic