ID: 961359143

View in Genome Browser
Species Human (GRCh38)
Location 3:126356657-126356679
Sequence GTCCGCGAAGGACTCGCGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961359141_961359143 0 Left 961359141 3:126356634-126356656 CCGCTGTGGCTGTGCGGGAGGCT 0: 1
1: 0
2: 3
3: 34
4: 310
Right 961359143 3:126356657-126356679 GTCCGCGAAGGACTCGCGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961359143 Original CRISPR GTCCGCGAAGGACTCGCGCG TGG Intronic
1084399491 11:68935432-68935454 GTCCCCAAAGGACTCTGGCGAGG - Intronic
1085266559 11:75241043-75241065 GGCCGCGATGGCCCCGCGCGCGG + Exonic
1132584540 16:700552-700574 GTCCGGGGAGGCCTGGCGCGGGG + Intronic
1142367440 16:89657543-89657565 GTCCTCCGGGGACTCGCGCGCGG - Intronic
1147123992 17:38352842-38352864 TTCCGAGAAGGACCCGCGAGTGG - Exonic
1147158895 17:38559454-38559476 AGCGGCGAAGGACTCGGGCGTGG + Intronic
1157609704 18:48948847-48948869 GTCCGCTCGGCACTCGCGCGGGG + Intronic
1160538906 18:79610017-79610039 GACCGCGAAGGACTTGCTCCGGG + Intergenic
928904821 2:36356980-36357002 CTCCCCGAGGGGCTCGCGCGCGG - Intronic
1171896455 20:30814063-30814085 CACCGCGTAGGTCTCGCGCGTGG - Intergenic
1180190908 21:46162026-46162048 CGCCGAGAAGGACGCGCGCGTGG - Exonic
961359143 3:126356657-126356679 GTCCGCGAAGGACTCGCGCGTGG + Intronic
968748247 4:2372258-2372280 TTCCGAGAAGGACTCGTGAGGGG + Intronic
969239070 4:5887865-5887887 CTCCCCGCAGGCCTCGCGCGGGG - Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1020130146 7:5555157-5555179 GTCCGCGCTGGACTCGCACGGGG - Intronic
1045510901 8:102811009-102811031 GTGCCCGCAGGACTCGGGCGGGG - Intergenic
1046659936 8:116938338-116938360 GTCCCCGAAGAAGTCGCACGCGG - Exonic
1047262395 8:123274475-123274497 GCGCGCGGAGGACGCGCGCGCGG - Exonic
1062388133 9:136322980-136323002 GGCCTCGAAGGAGTCTCGCGGGG - Intergenic
1200003667 X:153074282-153074304 GCCCGGGGAGGACTCGCGCTGGG - Exonic
1200004056 X:153075727-153075749 GCCCGGGGAGGACTCGCGCTGGG + Intergenic