ID: 961360053

View in Genome Browser
Species Human (GRCh38)
Location 3:126361320-126361342
Sequence GGAGGCCCTGGCAGTGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961360053_961360059 1 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360059 3:126361344-126361366 GAGATCCCAGTGCAGTGTAGGGG No data
961360053_961360057 -1 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360057 3:126361342-126361364 CTGAGATCCCAGTGCAGTGTAGG No data
961360053_961360060 2 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360060 3:126361345-126361367 AGATCCCAGTGCAGTGTAGGGGG No data
961360053_961360065 21 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360065 3:126361364-126361386 GGGGCCCAGCAGGATGACGGTGG No data
961360053_961360063 11 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360063 3:126361354-126361376 TGCAGTGTAGGGGGCCCAGCAGG No data
961360053_961360068 27 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360068 3:126361370-126361392 CAGCAGGATGACGGTGGTGCAGG No data
961360053_961360064 18 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG No data
961360053_961360058 0 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360058 3:126361343-126361365 TGAGATCCCAGTGCAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961360053 Original CRISPR GGAGGCCCTGGCAGTGTGAG TGG (reversed) Intergenic
No off target data available for this crispr