ID: 961360054

View in Genome Browser
Species Human (GRCh38)
Location 3:126361332-126361354
Sequence ACTGGGATCTCAGGAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961360054_961360068 15 Left 961360054 3:126361332-126361354 CCAGGGCCTCCTGAGATCCCAGT No data
Right 961360068 3:126361370-126361392 CAGCAGGATGACGGTGGTGCAGG No data
961360054_961360065 9 Left 961360054 3:126361332-126361354 CCAGGGCCTCCTGAGATCCCAGT No data
Right 961360065 3:126361364-126361386 GGGGCCCAGCAGGATGACGGTGG No data
961360054_961360069 23 Left 961360054 3:126361332-126361354 CCAGGGCCTCCTGAGATCCCAGT No data
Right 961360069 3:126361378-126361400 TGACGGTGGTGCAGGTGATAAGG No data
961360054_961360060 -10 Left 961360054 3:126361332-126361354 CCAGGGCCTCCTGAGATCCCAGT No data
Right 961360060 3:126361345-126361367 AGATCCCAGTGCAGTGTAGGGGG No data
961360054_961360063 -1 Left 961360054 3:126361332-126361354 CCAGGGCCTCCTGAGATCCCAGT No data
Right 961360063 3:126361354-126361376 TGCAGTGTAGGGGGCCCAGCAGG No data
961360054_961360064 6 Left 961360054 3:126361332-126361354 CCAGGGCCTCCTGAGATCCCAGT No data
Right 961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961360054 Original CRISPR ACTGGGATCTCAGGAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr