ID: 961360055

View in Genome Browser
Species Human (GRCh38)
Location 3:126361338-126361360
Sequence CACTGCACTGGGATCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961360055_961360068 9 Left 961360055 3:126361338-126361360 CCTCCTGAGATCCCAGTGCAGTG No data
Right 961360068 3:126361370-126361392 CAGCAGGATGACGGTGGTGCAGG No data
961360055_961360065 3 Left 961360055 3:126361338-126361360 CCTCCTGAGATCCCAGTGCAGTG No data
Right 961360065 3:126361364-126361386 GGGGCCCAGCAGGATGACGGTGG No data
961360055_961360069 17 Left 961360055 3:126361338-126361360 CCTCCTGAGATCCCAGTGCAGTG No data
Right 961360069 3:126361378-126361400 TGACGGTGGTGCAGGTGATAAGG No data
961360055_961360064 0 Left 961360055 3:126361338-126361360 CCTCCTGAGATCCCAGTGCAGTG No data
Right 961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG No data
961360055_961360070 30 Left 961360055 3:126361338-126361360 CCTCCTGAGATCCCAGTGCAGTG No data
Right 961360070 3:126361391-126361413 GGTGATAAGGACGAGTGTGAAGG No data
961360055_961360063 -7 Left 961360055 3:126361338-126361360 CCTCCTGAGATCCCAGTGCAGTG No data
Right 961360063 3:126361354-126361376 TGCAGTGTAGGGGGCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961360055 Original CRISPR CACTGCACTGGGATCTCAGG AGG (reversed) Intergenic
No off target data available for this crispr