ID: 961360056

View in Genome Browser
Species Human (GRCh38)
Location 3:126361341-126361363
Sequence CTACACTGCACTGGGATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961360056_961360069 14 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360069 3:126361378-126361400 TGACGGTGGTGCAGGTGATAAGG No data
961360056_961360071 28 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360071 3:126361392-126361414 GTGATAAGGACGAGTGTGAAGGG No data
961360056_961360072 29 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360072 3:126361393-126361415 TGATAAGGACGAGTGTGAAGGGG No data
961360056_961360070 27 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360070 3:126361391-126361413 GGTGATAAGGACGAGTGTGAAGG No data
961360056_961360073 30 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360073 3:126361394-126361416 GATAAGGACGAGTGTGAAGGGGG No data
961360056_961360068 6 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360068 3:126361370-126361392 CAGCAGGATGACGGTGGTGCAGG No data
961360056_961360065 0 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360065 3:126361364-126361386 GGGGCCCAGCAGGATGACGGTGG No data
961360056_961360064 -3 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG No data
961360056_961360063 -10 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360063 3:126361354-126361376 TGCAGTGTAGGGGGCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961360056 Original CRISPR CTACACTGCACTGGGATCTC AGG (reversed) Intergenic
No off target data available for this crispr