ID: 961360064

View in Genome Browser
Species Human (GRCh38)
Location 3:126361361-126361383
Sequence TAGGGGGCCCAGCAGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961360054_961360064 6 Left 961360054 3:126361332-126361354 CCAGGGCCTCCTGAGATCCCAGT No data
Right 961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG No data
961360056_961360064 -3 Left 961360056 3:126361341-126361363 CCTGAGATCCCAGTGCAGTGTAG No data
Right 961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG No data
961360053_961360064 18 Left 961360053 3:126361320-126361342 CCACTCACACTGCCAGGGCCTCC No data
Right 961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG No data
961360055_961360064 0 Left 961360055 3:126361338-126361360 CCTCCTGAGATCCCAGTGCAGTG No data
Right 961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961360064 Original CRISPR TAGGGGGCCCAGCAGGATGA CGG Intergenic
No off target data available for this crispr