ID: 961365159

View in Genome Browser
Species Human (GRCh38)
Location 3:126394979-126395001
Sequence GTGGGTGCGCTCGCGGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961365154_961365159 -5 Left 961365154 3:126394961-126394983 CCGGGGCAGTCGGGGTCGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 961365159 3:126394979-126395001 GTGGGTGCGCTCGCGGTCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961365159 Original CRISPR GTGGGTGCGCTCGCGGTCCG GGG Intronic