ID: 961365311

View in Genome Browser
Species Human (GRCh38)
Location 3:126395744-126395766
Sequence GTTCTAAGCACAGAAAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961365310_961365311 -10 Left 961365310 3:126395731-126395753 CCAAGATTGATGTGTTCTAAGCA 0: 1
1: 0
2: 0
3: 9
4: 123
Right 961365311 3:126395744-126395766 GTTCTAAGCACAGAAAAAGTAGG 0: 1
1: 0
2: 4
3: 29
4: 275
961365309_961365311 12 Left 961365309 3:126395709-126395731 CCGAAAATGCAAAGGCTTGAGGC 0: 1
1: 0
2: 3
3: 12
4: 184
Right 961365311 3:126395744-126395766 GTTCTAAGCACAGAAAAAGTAGG 0: 1
1: 0
2: 4
3: 29
4: 275
961365306_961365311 21 Left 961365306 3:126395700-126395722 CCGAGGAGGCCGAAAATGCAAAG 0: 1
1: 0
2: 0
3: 26
4: 817
Right 961365311 3:126395744-126395766 GTTCTAAGCACAGAAAAAGTAGG 0: 1
1: 0
2: 4
3: 29
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961365311 Original CRISPR GTTCTAAGCACAGAAAAAGT AGG Intronic
904619169 1:31765172-31765194 GCACTAAGCCCAGAAACAGTTGG + Intergenic
905918669 1:41704200-41704222 ATGCTTAGCACAGAACAAGTTGG - Intronic
906147522 1:43568858-43568880 GCTCTAAAGACACAAAAAGTTGG - Intronic
906454687 1:45983794-45983816 CTTGTTAGCACAGAAAAAGTTGG - Intronic
910693867 1:89992128-89992150 GTTCTAAGCACATTTAAGGTAGG + Intergenic
910708696 1:90156601-90156623 GTGCTAAGCAGAGAAGAAATAGG + Intergenic
912318506 1:108688606-108688628 GTTCTCAGAACACAAAAAGCAGG + Intergenic
913280569 1:117181482-117181504 GTTCTAAGCAGAGAGCAACTGGG - Intronic
913318272 1:117571156-117571178 GTTCCAGCCTCAGAAAAAGTGGG - Intergenic
913328971 1:117651589-117651611 ATTCTAAGCAGAGAAAATATAGG + Intergenic
917487242 1:175466478-175466500 GTTCCAAGCCCAGAAAGACTGGG - Intronic
917732393 1:177888392-177888414 GTTCTGAGCACATTTAAAGTAGG + Intergenic
917998619 1:180468301-180468323 GTCCTAAGCCCAGAAGCAGTAGG + Intronic
918345352 1:183602860-183602882 GGTCTAAACACAGAATAAGCGGG - Intergenic
919690671 1:200525986-200526008 ATTCTAAGCACAGATAAAATAGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921998359 1:221446774-221446796 GTTCTAACCACAGAGTAGGTGGG + Intergenic
924500987 1:244637719-244637741 GGTGTAGTCACAGAAAAAGTAGG - Intronic
1063007604 10:1988560-1988582 GTATTAAGCACAGAAAATGTGGG + Intergenic
1063339889 10:5253108-5253130 GTTCTAAGCATAGGCACAGTGGG - Intergenic
1063343849 10:5293542-5293564 GTTCTAAGCATAGGCACAGTGGG + Intergenic
1064913489 10:20429437-20429459 CTTCTAAGCACAGAAAGACCAGG - Intergenic
1064928845 10:20601268-20601290 TTTCTAAGCCAACAAAAAGTAGG + Intergenic
1065270336 10:24025058-24025080 TTTCTTAGAACACAAAAAGTGGG - Intronic
1066093218 10:32046934-32046956 GTTCTGAGCACATTTAAAGTAGG - Intronic
1069039348 10:63678687-63678709 ATTCAAAGCACAGAAAAATGTGG + Intergenic
1070606573 10:77902469-77902491 ATTGTAAGTACAGAAAAAATGGG + Intronic
1071754658 10:88523532-88523554 GTTCCAAGCTCAGAAACATTTGG + Intronic
1072186135 10:93040900-93040922 GTTCTAAGGACAGAAACCTTGGG - Intronic
1072469262 10:95697134-95697156 GCTCTAAGCACACAGAAAGAAGG + Intergenic
1073508502 10:104024666-104024688 GTACAAAGCACAGGAAAAGAAGG - Intronic
1073796174 10:106990568-106990590 GTTCTGAAGAAAGAAAAAGTTGG - Intronic
1074126494 10:110532661-110532683 GCTCTAAGAACAAAAACAGTAGG + Intergenic
1076030554 10:127154181-127154203 GTTATAAGCACAGGGAATGTGGG + Intronic
1077729649 11:4716255-4716277 TGTCTGAGCACAGCAAAAGTAGG - Intronic
1077769923 11:5206035-5206057 GTTCTCACCACAAAAAAAGTTGG - Intergenic
1077838750 11:5948984-5949006 GTTCTAAGCACAGACACATTGGG - Intergenic
1079321154 11:19452634-19452656 GTTCTAAGCACATTTAAAGTAGG - Intronic
1079416354 11:20239803-20239825 GTTCTAGGCACAGAACCAGAGGG - Intergenic
1079781071 11:24606355-24606377 GTTCTGAGCACATTTAAAGTAGG + Intronic
1080062186 11:27968876-27968898 TTTCTAAGCACTGAAACTGTTGG - Intergenic
1080349276 11:31364123-31364145 GTTCTGAGCACAATTAAAGTAGG + Intronic
1080918845 11:36688401-36688423 GTTCTGGGGTCAGAAAAAGTAGG + Intergenic
1082948662 11:58787943-58787965 GATCTATGCACAGAAAGAGTTGG - Intergenic
1083957467 11:65993064-65993086 GTTCTATTACCAGAAAAAGTGGG - Intergenic
1085732956 11:79014726-79014748 GTTATAACCACAGAGAAAGCCGG + Intronic
1085780854 11:79407779-79407801 ATTCTTAGCACAGAAAAGTTTGG - Intronic
1086418276 11:86611435-86611457 GTTCTCAACACAAAAAAAGGTGG + Intronic
1086731208 11:90251759-90251781 GTTCTAAGCAAAGGAATAGCAGG + Intergenic
1087008236 11:93489567-93489589 GGTGTAGGCATAGAAAAAGTAGG + Intronic
1087581346 11:100059331-100059353 TTTCTAAACACACAAAAAATCGG + Intronic
1087791245 11:102408354-102408376 ATTCTAATCACAGAAAAATTAGG - Intronic
1087973067 11:104509653-104509675 GTTCTGAGCACATATAAGGTAGG + Intergenic
1088129977 11:106476151-106476173 GTTCTTACCACAAAAAAAGAAGG - Intergenic
1088740630 11:112764079-112764101 GTTATAAGCATAGATTAAGTTGG + Intergenic
1091030102 11:132178911-132178933 ATTCAAAGCAAAGAAAAACTTGG + Intronic
1091504035 12:1048839-1048861 CTTCTGATCACAGAAACAGTTGG + Intronic
1092608046 12:10141633-10141655 GTTCTAAGCATTGACAGAGTTGG - Intergenic
1093552566 12:20432452-20432474 GTTCTTATCACAAAAAAAGGTGG + Intronic
1094050212 12:26211764-26211786 TGTCCAAGCACAGAAAGAGTGGG - Intronic
1094228379 12:28073523-28073545 GTTCTCACCACAAAAAAACTAGG + Intergenic
1098732079 12:74049042-74049064 GTTCTAAGTACAGTAACATTTGG - Intergenic
1100170286 12:91968104-91968126 GGGCTAAGCAGAGAAATAGTTGG + Intergenic
1106680743 13:32004385-32004407 GTTCTAAGCAGCGAAAAAATTGG - Intergenic
1107607404 13:42073588-42073610 GTTCTGAGCACATGTAAAGTAGG + Intronic
1108420777 13:50246878-50246900 GTTCCCAGCACAGGAAGAGTGGG - Intronic
1110386479 13:74917611-74917633 GTTATGATCACAGAAAAATTGGG + Intergenic
1111760633 13:92459497-92459519 GTTCTTGGCACAGAAGAAGTCGG + Intronic
1111947346 13:94679740-94679762 GTTCTGATCACAAATAAAGTAGG - Intergenic
1112611217 13:100956601-100956623 GTTCAAATCTCAGAAACAGTGGG + Intergenic
1112709877 13:102115280-102115302 GTTGTAAGCACAGAGAGGGTGGG - Intronic
1114467528 14:22934105-22934127 GTTCTGAACATAGAAAAAGATGG + Intergenic
1117371521 14:55082795-55082817 GTTCTAAGCACATTTAAGGTAGG - Intergenic
1117386365 14:55217761-55217783 GTTCTAAGTAGAGAAAAAACAGG + Intergenic
1118824282 14:69366356-69366378 GTGCTAAGCAGAGAATAACTTGG - Intergenic
1118835141 14:69472607-69472629 TGTCTAACCACAGAAAAAGGTGG - Intergenic
1120728083 14:87968979-87969001 GTTCTAAGGACAGGAGTAGTGGG - Intronic
1120812735 14:88821063-88821085 ATTTTAAGCACAAAACAAGTGGG + Intergenic
1123013312 14:105359928-105359950 CATTTAAACACAGAAAAAGTAGG - Intronic
1124472592 15:30001564-30001586 GTTGTCAGCAAAGAAAAGGTGGG - Intergenic
1124952443 15:34336688-34336710 TTTTTAAGAACAAAAAAAGTGGG + Exonic
1125147603 15:36490426-36490448 TTTCTAACCACAGAACCAGTGGG - Intergenic
1126217877 15:46177381-46177403 GTTCTAAGCAGAGGAAAGGAAGG - Intergenic
1126263631 15:46726011-46726033 GTAATAAGCACAGAATATGTGGG + Intergenic
1127463558 15:59222546-59222568 TTTCTGAACACAGAAAAAGATGG - Intronic
1127676472 15:61243988-61244010 GTTCTAGGGACAGAAAAACCTGG + Intergenic
1128922702 15:71626877-71626899 TTTCTGAGTACAGAAAAAGAAGG - Intronic
1129504398 15:76069299-76069321 GATCAAAGGACAGAAAAAGCAGG + Intronic
1130715526 15:86329837-86329859 GATCTCTGCACAGGAAAAGTGGG - Intronic
1131275609 15:90978220-90978242 ATTCTAAGTATAGCAAAAGTTGG + Intronic
1131995795 15:98131656-98131678 GTTCTGAACTCAGAAACAGTGGG - Intergenic
1133655679 16:7861498-7861520 GTTCTTAGAACAAAAAAAGACGG + Intergenic
1134651133 16:15909797-15909819 GTTTTAAGAGCAGAAAAAATAGG - Intergenic
1134799912 16:17074552-17074574 GATCTCATCTCAGAAAAAGTGGG - Intergenic
1137777578 16:51069317-51069339 GTACTGAGCACAGAACAGGTGGG + Intergenic
1139762631 16:69198577-69198599 GACCCAAGCACAGAAGAAGTAGG - Intronic
1139823332 16:69737965-69737987 GTTCTAAGCCCAGTAAAGGATGG - Intergenic
1141285238 16:82665790-82665812 GCTCTAAGCACATATAAAGTAGG - Intronic
1141342200 16:83213456-83213478 CTTCTCTGCTCAGAAAAAGTTGG - Intronic
1141483159 16:84320223-84320245 GTTCTGAGCACAGTTAAGGTAGG + Intronic
1141945436 16:87305903-87305925 GTGCTAGGCAAAGAAAAGGTGGG + Exonic
1142726935 17:1822519-1822541 TTTCAGAGCACAGAAAAAGGCGG + Intronic
1142818114 17:2444026-2444048 GTTCTCACCACACAAAAAATTGG + Intronic
1145763542 17:27442306-27442328 GTTCTGAGCACATTTAAAGTAGG + Intergenic
1148338780 17:46860754-46860776 GTGCTGAGCACAGAAAAGGCTGG - Intronic
1148398586 17:47332395-47332417 GTTCTTACCACAAAAAAAGTTGG - Intronic
1149034721 17:52120823-52120845 GCTCTCAGCAAAGAAAGAGTGGG - Intronic
1150152534 17:62822222-62822244 GCTTAAAGTACAGAAAAAGTGGG - Intergenic
1151934223 17:77252036-77252058 ATTCTCAGCAAAGAAATAGTGGG - Intergenic
1153011281 18:541877-541899 GTTCTGAGCACTCATAAAGTTGG + Intergenic
1153036193 18:764657-764679 GTTTAAAGCTCAGAAAAAGATGG + Intronic
1153501689 18:5756206-5756228 GTTCTAGGCACAGGAGAAGGAGG - Intergenic
1153553056 18:6282673-6282695 GTTTTAAGCAAAGGAAAGGTAGG + Intronic
1154955251 18:21247578-21247600 CTCCTAAGCACACAAAAAGTTGG - Intronic
1155614111 18:27701579-27701601 GTTCTAGGCAGAGAGAAAGTGGG + Intergenic
1155676930 18:28440899-28440921 GATCTCTGCACAGAAAGAGTGGG + Intergenic
1156911019 18:42411042-42411064 GTACTAAGCCCAGATAAAGATGG - Intergenic
1157696008 18:49724326-49724348 GTTCTAAGCACAGAAAATGCTGG - Intergenic
1158916193 18:62133161-62133183 GTTCTCAGCACATTAAAGGTAGG + Intronic
1160258958 18:77273296-77273318 GTTCTAGGTGCAGAAATAGTGGG + Exonic
1167296871 19:48655727-48655749 CTACTAAACACAGAAAAAATAGG - Intergenic
1167377773 19:49120573-49120595 GTTCTAAGCAGAGCAAACGCTGG - Intronic
926427487 2:12752596-12752618 GTTCCAAGCACAGTTAAGGTAGG + Intergenic
926434201 2:12821964-12821986 GTTCTAAGGACAGAAAATGAAGG - Intergenic
927145122 2:20159555-20159577 GTTATAAGCACATGAAAAGATGG - Intergenic
928628656 2:33168077-33168099 GTTGTAAGAACAGAAAATGGAGG + Intronic
929872595 2:45771616-45771638 GTTCTAAGAAAAGACAAAGGGGG - Intronic
930386924 2:50708778-50708800 GTTTCAAGAAAAGAAAAAGTGGG - Intronic
932035309 2:68240030-68240052 GTTCTAAGCACATTTAAGGTAGG + Intronic
934148519 2:89120354-89120376 GTACTAAAAACAGAAAAATTAGG + Intergenic
934218774 2:90061656-90061678 GTACTAAAAACAGAAAAATTAGG - Intergenic
936784212 2:116073542-116073564 GATATAATGACAGAAAAAGTTGG + Intergenic
937147979 2:119663665-119663687 GTTGTAGGCAAAGAAGAAGTGGG + Intergenic
937192270 2:120114460-120114482 GTTCTGAGCACAGTTAATGTAGG + Intronic
937664845 2:124474685-124474707 GTTTTAAGCTCAGAAAGATTAGG - Intronic
939724023 2:145691946-145691968 GTTCTAGACCCTGAAAAAGTTGG - Intergenic
940455592 2:153894697-153894719 CTTCTAAGAGCAGAAAAAATGGG + Intronic
941312187 2:163947455-163947477 GCACTTAGCAAAGAAAAAGTAGG - Intergenic
941713856 2:168743819-168743841 GTTCTAAGCACACACTTAGTTGG - Intronic
942030904 2:171957991-171958013 GTTTAAAGCCCTGAAAAAGTTGG - Intronic
944380021 2:199097681-199097703 GTTCTGAGCACATTTAAAGTAGG - Intergenic
944999298 2:205331466-205331488 TTTCTAAGAACAGAAAAGATGGG - Intronic
945222760 2:207501593-207501615 CATCTAAGCATAGAAAAAATCGG + Intergenic
945247294 2:207730181-207730203 GTTCTGGGCTCAGAAATAGTAGG - Intronic
945373007 2:209044271-209044293 TTTCTAAGCTCACATAAAGTAGG - Intergenic
948293014 2:236841493-236841515 GTTCTCAGCACACACCAAGTGGG + Intergenic
1169233172 20:3906501-3906523 GTTCTAAGCACATTTAAGGTAGG - Intronic
1170096112 20:12647666-12647688 GTTCTGAGCACATTTAAAGTAGG + Intergenic
1170323427 20:15128187-15128209 GTTTTTAGAACAGAGAAAGTGGG + Intronic
1170998711 20:21391939-21391961 TTTCTAAGCATAGCAAAATTCGG - Intergenic
1171209718 20:23308005-23308027 GTTCTCAGAACATAAAAGGTGGG - Intergenic
1171754333 20:29088011-29088033 GTCCTTAGCACAGAAGAACTGGG + Intergenic
1172296236 20:33813009-33813031 GTACTAAACACACAAAAAGATGG + Intronic
1172606919 20:36220255-36220277 GTTCTAAGCAAAGCAGAAGAGGG + Intronic
1173045748 20:39508767-39508789 GTTCTAAGCACATCTAAGGTAGG + Intergenic
1175160834 20:57006378-57006400 GATGAAAGCTCAGAAAAAGTGGG + Intergenic
1177118597 21:17114709-17114731 CTTTTAAGAACACAAAAAGTAGG + Intergenic
1181037023 22:20174637-20174659 GGTCAGAGTACAGAAAAAGTGGG + Intergenic
1184064225 22:42107182-42107204 GTTTTAAGAAAAGAGAAAGTAGG + Intergenic
1184889981 22:47373713-47373735 GGTCAAAGCAAAGAAAAAGAGGG - Intergenic
1185105429 22:48866857-48866879 GATTTATGAACAGAAAAAGTAGG - Intergenic
1185389629 22:50552076-50552098 GGACTATGCAGAGAAAAAGTTGG - Intronic
950410507 3:12833391-12833413 GTTTTAAGCACAGCAAATATAGG + Intronic
950656164 3:14438143-14438165 GTTTTAAAAAAAGAAAAAGTGGG - Intronic
951298315 3:20967204-20967226 GTTCTAAACACAGAAATAAAAGG - Intergenic
953270314 3:41436213-41436235 GTTCTGAGCACATATAAGGTAGG + Intronic
954816238 3:53283007-53283029 TATCTAAACACAGAAAAGGTCGG + Intergenic
954869528 3:53757287-53757309 GTTCTAAGGACAGTAATACTTGG - Intronic
955683943 3:61531166-61531188 GTACTAAACATAGAAAAAGATGG + Intergenic
956601814 3:71030462-71030484 GTTCTGGAAACAGAAAAAGTAGG - Intronic
957029798 3:75227326-75227348 ATTGTAAGCCCAGAAAAATTAGG + Intergenic
957198734 3:77104493-77104515 GTTCATAGCAGAAAAAAAGTGGG - Intronic
957955147 3:87176907-87176929 GTTCTAATAAAAGAAAAAGGAGG - Intergenic
958497586 3:94864434-94864456 GATCTATGCACAGGAAAGGTAGG + Intergenic
960675252 3:120187316-120187338 GTTCTGAGCACATTAAAGGTAGG - Intronic
961365311 3:126395744-126395766 GTTCTAAGCACAGAAAAAGTAGG + Intronic
961384055 3:126514736-126514758 GTTTTCAGTAAAGAAAAAGTAGG + Intronic
962874304 3:139524134-139524156 GTCATAAGAACAGAAAAAGGAGG + Intronic
963721972 3:148871938-148871960 GTTCTAAGAACAGAAACATCTGG + Intronic
963745520 3:149120611-149120633 GCTCTAAGCACAGAAAAAAGGGG + Intergenic
966591510 3:181688671-181688693 GTAATAAGGACAGAAAAACTTGG + Intergenic
966941366 3:184749973-184749995 GCTCGAATCACAGAGAAAGTGGG - Intergenic
967704196 3:192630856-192630878 TTTCTAAGAAAAAAAAAAGTGGG - Intronic
969942190 4:10744551-10744573 ATTCTAAGTACAAACAAAGTTGG + Intergenic
970217435 4:13774797-13774819 GTTCTAAGCACTTTTAAAGTAGG + Intergenic
970336787 4:15055070-15055092 GTTATTAGCACATAAAAACTAGG + Intronic
970778490 4:19706512-19706534 GTTCTAAGTACAGGAAAGGTAGG - Intergenic
971158929 4:24113485-24113507 TCTCTATGCACAGAGAAAGTGGG - Intergenic
971176539 4:24287823-24287845 GTTATATGCTCAGAAAAAGACGG + Intergenic
971750195 4:30637162-30637184 CTTCTTATCACAGAAAATGTGGG + Intergenic
972046167 4:34666911-34666933 TGTCCAAGCACAGAAAAAGATGG + Intergenic
974077207 4:57178067-57178089 ATTATAAGCACCTAAAAAGTAGG - Intergenic
975276362 4:72506171-72506193 GATCTATGCACAGGAAAAGTGGG + Intronic
975866093 4:78725106-78725128 GTTCTATGAACAGAAATTGTTGG - Intergenic
976469823 4:85415306-85415328 GTTCTGAGCACATTTAAAGTAGG - Intergenic
979429568 4:120612382-120612404 GTTCAAAGCAGAAAAAAAGATGG - Intergenic
980608097 4:135120202-135120224 GTTCTAAGCACATTTAAGGTAGG - Intergenic
980764921 4:137289446-137289468 TTTCCAAGGACAGAAAAAGATGG + Intergenic
981321038 4:143391566-143391588 TTTCAAAGCACAGAAAAAGGCGG + Intronic
982595818 4:157381796-157381818 GTTTTAAGCAGAGAATAAGTAGG - Intergenic
986132288 5:4942641-4942663 GTTCTAATCACATGAAAAATGGG + Intergenic
988834157 5:35015091-35015113 TTTTGAAGCACAGAAGAAGTCGG - Intronic
988914133 5:35875427-35875449 ATTCCAAGCTCAGAATAAGTGGG + Intronic
988961771 5:36378166-36378188 GTTCCATGCACAAAAAAAGGGGG + Intergenic
990021850 5:51137443-51137465 TATCTATGCCCAGAAAAAGTTGG - Intergenic
990469031 5:56096727-56096749 GTTCTGAGCACATTAAAGGTAGG + Intergenic
991754657 5:69852777-69852799 GTACTAAGAACACAAAAAATTGG + Intergenic
991804276 5:70409527-70409549 GTACTAAGAACACAAAAAATTGG + Intergenic
991822426 5:70577737-70577759 GTACTAAGAACACAAAAAATTGG - Intergenic
991886990 5:71281701-71281723 GTACTAAGAACACAAAAAATTGG - Intergenic
992885281 5:81152591-81152613 ATTTTAAGCACATAAAATGTTGG - Intronic
993278547 5:85894324-85894346 GTTTTAAGCCCAGAAAAGTTGGG - Intergenic
994254937 5:97581600-97581622 GTTCTTAGCAATGAAAAAGGAGG - Intergenic
994824730 5:104698655-104698677 AATCTATGCACAGAAAGAGTGGG - Intergenic
995522242 5:113020496-113020518 GTTATAAGAACAGAAACATTTGG + Exonic
996045237 5:118864556-118864578 GTTTTAAGCCCAGAAAAGTTGGG + Intronic
996136056 5:119843845-119843867 TTTAAAAGCACAGAAAAAGAGGG - Intergenic
996569542 5:124917564-124917586 GTTCTAAGCACATTTAAGGTAGG + Intergenic
996907793 5:128621389-128621411 GTTTTAAGTAAAGAAACAGTGGG - Intronic
996959371 5:129227368-129227390 GTTCTGAGCACATTTAAAGTAGG + Intergenic
997307861 5:132852683-132852705 GTTCTAGGAACAGAAAGAGCTGG - Intergenic
997466532 5:134091724-134091746 GTTCTAAGCACTGACCACGTGGG + Intergenic
997855926 5:137372702-137372724 ATGCTAAGCACAGAAAAATATGG + Intronic
997936966 5:138120932-138120954 GTTCTGAGCACATTTAAAGTAGG - Intronic
999443504 5:151620830-151620852 GTCCTAATCATAGACAAAGTGGG + Intergenic
1000624466 5:163523642-163523664 GTTCTAAGCACATAAAGCCTGGG - Intergenic
1000929706 5:167236532-167236554 GTTTTAGAAACAGAAAAAGTAGG - Intergenic
1001886954 5:175301290-175301312 GTCCTAAGCAGAGAAAAAGCAGG + Intergenic
1001996694 5:176166715-176166737 GTCTCAAGCACAGAAAAAATGGG + Intergenic
1004405927 6:15333536-15333558 ATTCTAAGAACTGAAAAAGGAGG - Intronic
1011258267 6:85446264-85446286 GTTCTCACCACAGAAAAAGTGGG + Intergenic
1012039059 6:94181525-94181547 GTTAGAAGCACAGAAAATATAGG + Intergenic
1012041711 6:94213720-94213742 GTTTTAAGGAAAGAAAATGTAGG - Intergenic
1012742162 6:103031380-103031402 GTTCTTACCACAAAAAAAGTTGG + Intergenic
1013840384 6:114385162-114385184 GATAAAAGCACAGAAAAAGATGG - Intergenic
1014184039 6:118415156-118415178 GTTCTCACCACAAAAAAAATAGG + Intergenic
1018405599 6:163478970-163478992 GTTTTAAGCACAAAAAAATCTGG - Intronic
1020428270 7:8094053-8094075 TATCAAAGGACAGAAAAAGTAGG + Intronic
1020463613 7:8451486-8451508 GTTCCAAAGACAGAAAAACTTGG - Intronic
1021351824 7:19602953-19602975 GATCTATGCACAGGAAGAGTGGG + Intergenic
1021743954 7:23719418-23719440 GCTCTAACCAAAAAAAAAGTGGG + Intronic
1024466786 7:49719845-49719867 GTTCTAAGCAATGCAACAGTGGG + Intergenic
1024496608 7:50055372-50055394 GTTTTAAGCATAAAAAGAGTAGG + Intronic
1025156939 7:56615421-56615443 GGGCAAAGCACAGGAAAAGTAGG + Intergenic
1026243771 7:68599959-68599981 TTTCTCAGCAAAGAAAAACTAGG + Intergenic
1027199755 7:76056286-76056308 GTTCTAAACACAGAATTAGTAGG + Intronic
1027725770 7:81804152-81804174 TTTATAAGCACAGGAAAAGCTGG - Intergenic
1030137003 7:106263011-106263033 GTTGTTAGCACAGAAGAAATAGG - Intronic
1030247837 7:107404724-107404746 GTTCTAAGAAAATAAAAAATAGG + Intronic
1031247215 7:119329837-119329859 ATTTTAAGCACATAAAAACTTGG + Intergenic
1031597572 7:123665730-123665752 GTTCTAAGAACAGCAAACCTTGG - Intergenic
1033679639 7:143581443-143581465 GTTCTAAGCACGGTTAAGGTGGG - Intergenic
1033692197 7:143748000-143748022 GTTCTAAGCACGGTTAAGGTGGG + Intergenic
1034178184 7:149116814-149116836 ATTTTAAGCAGAGAAAAACTAGG - Intronic
1034412510 7:150948614-150948636 CTCCTTAACACAGAAAAAGTAGG + Intronic
1035108539 7:156461820-156461842 GTTCACAGGACACAAAAAGTGGG + Intergenic
1036799872 8:11782497-11782519 GTTCTGAGCACATATAAGGTAGG - Intronic
1037601297 8:20396724-20396746 ATTCTCACCACAAAAAAAGTGGG - Intergenic
1039200267 8:35083491-35083513 TTTCTAAGCATAGAAAAAATGGG - Intergenic
1041032132 8:53747848-53747870 GCTCTAAGCACAGAAGTGGTGGG + Intronic
1041855909 8:62454884-62454906 GCTTTCAGGACAGAAAAAGTTGG - Intronic
1042338037 8:67649164-67649186 TTTTTAAGCAGAGAAAATGTAGG - Intronic
1043217254 8:77607339-77607361 TTAATAAGAACAGAAAAAGTTGG + Intergenic
1044173034 8:89080806-89080828 GCCCTAAGCACAAAAAAATTTGG + Intergenic
1044256383 8:90068021-90068043 GTTCTAAAAATAGAAAAAGTAGG + Intronic
1045275934 8:100705699-100705721 GTTTAAAGCACAGAAAAAGATGG + Intronic
1046345200 8:112914938-112914960 ATTCTGATCACATAAAAAGTTGG - Intronic
1046718125 8:117589327-117589349 GTGCTCAGCACAGGAAAAGAGGG + Intergenic
1046861339 8:119094990-119095012 GTTCTAATCACAGCAAAAAATGG + Intronic
1047515868 8:125554484-125554506 TTTCTAAGCAGAGAGAAAGAGGG + Intergenic
1048549752 8:135423407-135423429 GATATAAGCACCGTAAAAGTAGG - Intergenic
1050313108 9:4373108-4373130 GTTCCAAGCACAGAAAAATACGG + Intergenic
1050632211 9:7572058-7572080 GATCTAAGCAGAGAATAAATAGG - Intergenic
1051289646 9:15532361-15532383 ATTCTCAGCAAAGAAATAGTGGG + Intergenic
1052447032 9:28576108-28576130 GTTCTAAGCACATTTAAGGTAGG - Intronic
1052674376 9:31600622-31600644 GTGCTAAGCACATAAGAAATAGG - Intergenic
1053566020 9:39252132-39252154 TTTCTAAAAACAGAAAAAGAGGG + Intronic
1053831787 9:42089982-42090004 TTTCTAAAAACAGAAAAAGAGGG + Intronic
1054131128 9:61366910-61366932 TTTCTAAAAACAGAAAAAGAGGG - Intergenic
1054598757 9:67097464-67097486 TTTCTAAAAACAGAAAAAGAGGG - Intergenic
1055191964 9:73535933-73535955 GTTCTTAGCACATATAAGGTGGG + Intergenic
1055703172 9:78968834-78968856 GTTCTAAGCACATTTAAGGTAGG - Intergenic
1056243775 9:84673623-84673645 GTTCTAAGAACACAAATAGTGGG + Intronic
1057059747 9:91993027-91993049 GATCTTAGCAAAGAAGAAGTCGG - Intergenic
1059602845 9:115800160-115800182 GTTCTAGGCACTCTAAAAGTAGG - Intergenic
1059636969 9:116180467-116180489 TTACTAAGCACAGACTAAGTGGG - Intronic
1060335852 9:122721229-122721251 GATCTATGGAGAGAAAAAGTTGG + Intergenic
1061181826 9:129028861-129028883 GTTCTAACCACAAAAAAAGTAGG - Intergenic
1061969758 9:134038318-134038340 CTACTAAGAACAGAAAAAATTGG - Intronic
1185554311 X:1008369-1008391 GTTCTAAGAGAAGAAAAAGCAGG + Intergenic
1186135318 X:6513638-6513660 GTACTAAGCTCAGTAAACGTTGG + Intergenic
1186390962 X:9158711-9158733 TTTTTAAACAGAGAAAAAGTGGG - Intronic
1186502443 X:10062519-10062541 GGTCTAGGGACAGAAGAAGTGGG + Intronic
1188213590 X:27451616-27451638 AATCTAAGCACATAAATAGTAGG - Intergenic
1190535154 X:51418563-51418585 TTTCAAAGCACAGAAAATTTAGG - Intergenic
1192785475 X:74330938-74330960 GTTCTGAATAAAGAAAAAGTAGG + Intergenic
1193325724 X:80176853-80176875 GCTTTAAGCAATGAAAAAGTTGG + Intergenic
1195013348 X:100754296-100754318 GTTCTGAGCACATTTAAAGTAGG - Intergenic
1196034829 X:111132784-111132806 GAGCTAGGCACATAAAAAGTAGG - Intronic
1197381224 X:125743245-125743267 TTTCTATGCACAAAAAAAATGGG + Intergenic
1198555003 X:137783472-137783494 GGAATAAGCAAAGAAAAAGTGGG + Intergenic
1198582758 X:138084637-138084659 GTTCTAAGCACAGAAAAAAGTGG - Intergenic
1198630411 X:138630872-138630894 GTTCTAAGCACATTTAAAGTAGG - Intergenic
1198651297 X:138866366-138866388 CTTCTAAGCTCAGAAAAACATGG - Intronic
1199275806 X:145940500-145940522 ATTCTAAGCAAAGATAAAGCTGG - Intergenic
1200503455 Y:3981737-3981759 GATCTCAGCACAGAAATTGTAGG - Intergenic
1201734988 Y:17249686-17249708 CTTCTCAGCACATTAAAAGTAGG - Intergenic
1201786973 Y:17795181-17795203 GTTCTAAGATAAGAAACAGTAGG - Intergenic
1201814580 Y:18110807-18110829 GTTCTAAGATAAGAAACAGTAGG + Intergenic