ID: 961365642

View in Genome Browser
Species Human (GRCh38)
Location 3:126397843-126397865
Sequence ATGCTGAGCCAAGTACAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961365634_961365642 17 Left 961365634 3:126397803-126397825 CCAAAATGACACTGAGCCACCTG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 961365642 3:126397843-126397865 ATGCTGAGCCAAGTACAGATAGG 0: 1
1: 0
2: 0
3: 1
4: 124
961365641_961365642 -2 Left 961365641 3:126397822-126397844 CCTGGAGTGAGAGGTTTGGGGAT 0: 1
1: 0
2: 2
3: 19
4: 218
Right 961365642 3:126397843-126397865 ATGCTGAGCCAAGTACAGATAGG 0: 1
1: 0
2: 0
3: 1
4: 124
961365638_961365642 1 Left 961365638 3:126397819-126397841 CCACCTGGAGTGAGAGGTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 961365642 3:126397843-126397865 ATGCTGAGCCAAGTACAGATAGG 0: 1
1: 0
2: 0
3: 1
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961365642 Original CRISPR ATGCTGAGCCAAGTACAGAT AGG Intronic
903031063 1:20464698-20464720 ATGCTGTGCCAAGTGCAGTGAGG - Intergenic
903398907 1:23024369-23024391 AAGCTGAGGCCAGTATAGATAGG + Intronic
907344882 1:53767919-53767941 CTGCTGATACAACTACAGATGGG - Exonic
909743961 1:79069257-79069279 AAGCTGAGCCAATTCCAAATAGG + Intergenic
910485272 1:87706220-87706242 AGGCTGAGCCAACTCTAGATTGG - Intergenic
911292601 1:96075921-96075943 CTGCTGAACCAAGAAAAGATTGG - Intergenic
911808733 1:102245719-102245741 ATGTTGAGCCAGGCACAGAAAGG - Intergenic
913123410 1:115763043-115763065 AAACTGAGCCAAGTTCACATTGG - Intronic
915541685 1:156571329-156571351 GTGCTGAGTCAAAGACAGATTGG - Intronic
917714717 1:177722430-177722452 ATTCTGAGGCAACTAGAGATTGG + Intergenic
918526188 1:185467348-185467370 ATGCTGAGGGAAGTTCAGCTGGG - Intergenic
919870566 1:201817833-201817855 AGGCTAAGCCAAGTACAAACTGG + Intronic
924010087 1:239655203-239655225 ATGCTGAACCAAGTATAGTAAGG + Intronic
924639753 1:245822760-245822782 ATGGAGAGCCAAGTACAAAGTGG - Intronic
1064266007 10:13826029-13826051 ATGCTGATCAAGGTACACATCGG - Intronic
1065364587 10:24922994-24923016 CTGCTGAGCCAGGCACAGACAGG - Intronic
1067272318 10:44803134-44803156 AGGCTGAGCCAAGTGAAGCTTGG + Intergenic
1067526011 10:47039011-47039033 TTGCTTCACCAAGTACAGATTGG - Intergenic
1072741471 10:97912528-97912550 ATGCAGACCCAAGTACAAGTCGG + Intronic
1074365729 10:112856092-112856114 GCGCTCAGCCAGGTACAGATGGG + Intergenic
1074824876 10:117207482-117207504 GTGCTGAGCAAAGTAGATATGGG - Intronic
1076880133 10:133235935-133235957 GTGCTGAACCACGTACAGAAGGG + Intergenic
1077709764 11:4523909-4523931 TTTCTGAGCCAAGTAAAGCTTGG - Intergenic
1078093317 11:8281208-8281230 ATGAAGAGACAAGTAGAGATGGG + Intergenic
1079309536 11:19352465-19352487 AGCCAGAGCCAAGAACAGATGGG - Intronic
1079503824 11:21132437-21132459 AGGGTGAGCCAGGTACAGAGCGG + Intronic
1084319343 11:68364836-68364858 ATGCTGCCCCAAGTGTAGATGGG - Intronic
1084489029 11:69468202-69468224 CAGCAGAGCCAAGTACAAATTGG + Intergenic
1090434870 11:126678261-126678283 ATGCTGACTCCAGCACAGATGGG + Intronic
1093438444 12:19164597-19164619 GTGCTGAGCCAGGTAAAGAAGGG - Intronic
1094258686 12:28465449-28465471 ATTCTGAGCCAACTAGAGCTGGG - Intronic
1096155657 12:49340014-49340036 ATGCAGAGTCAAGGACAGACTGG - Intergenic
1100741160 12:97595232-97595254 ATGCTGATCCATGTACAAAATGG - Intergenic
1106177559 13:27344180-27344202 TTGCTCAGCAAAGCACAGATGGG + Intergenic
1109348596 13:61146338-61146360 AGGCTGAGCCATGTGCAGAGTGG - Intergenic
1110360553 13:74620380-74620402 ATTCTGAGCCAAGTTTAGCTTGG - Intergenic
1111679897 13:91429468-91429490 ATGGGGATCCAAGTAGAGATTGG + Intronic
1118336358 14:64856457-64856479 ATGCTTAGCCAAGTTCAGCAAGG + Intronic
1119466123 14:74860168-74860190 ATGCTGAGCCAAATGGAGTTTGG + Intronic
1122256704 14:100483415-100483437 ATGGTGGCCCAAGCACAGATTGG - Intronic
1124222748 15:27864148-27864170 GTGCTGAGCCTGGTACTGATGGG - Intronic
1128411671 15:67405690-67405712 ACACTGAGCCAAGTACATTTAGG + Intronic
1128843162 15:70866859-70866881 ATGATTGGCCAAGTAGAGATTGG + Intronic
1130092184 15:80830208-80830230 ATGCTGAGCCAATGACCAATAGG - Intronic
1132987116 16:2773162-2773184 ACCCTGAGCCAAGCAGAGATGGG - Intronic
1133426400 16:5694091-5694113 CTTCTGAGCCAAGCACAGCTGGG - Intergenic
1138885517 16:61073137-61073159 ATTCTGAGCCAATGACTGATGGG - Intergenic
1140785860 16:78341612-78341634 ATGCTGAGATAAGTCTAGATGGG + Intronic
1142227829 16:88886059-88886081 ATGCTGGGCCAAGTACTGGGCGG + Exonic
1156881989 18:42091845-42091867 ATTCTGAGCCAAATACGGGTGGG + Intergenic
1163962212 19:20707511-20707533 AGGCTGAGCGAATTACTGATTGG - Intronic
1166397373 19:42451585-42451607 ATGTTGAGCCAAGCCCAGAGTGG - Intergenic
925536974 2:4928506-4928528 ATGCTGAGCCACTTGCAGAGTGG - Intergenic
927336161 2:21927103-21927125 ATGCTGGGCCAAGGCAAGATTGG - Intergenic
928194953 2:29208972-29208994 AGGCTGCGCTAAGTACTGATGGG + Intronic
928441688 2:31297401-31297423 ATGCAGAAGCAAGCACAGATTGG - Intergenic
932372570 2:71204032-71204054 ATGCTGTACTAAGTACAGAAGGG - Intronic
933056288 2:77671410-77671432 ATGTTGAGCCAAATAGAGAGAGG - Intergenic
933927842 2:87115725-87115747 ATGTTGAGCCAAATAGAGAGAGG - Intergenic
936548207 2:113411259-113411281 ATACTGTGCCCAGTACAGAGAGG + Intergenic
937077275 2:119116511-119116533 CTGCTAAGCCAAGAACAGAGGGG + Intergenic
937592024 2:123625877-123625899 ATGCTGAGCAAAGGACAAAGAGG + Intergenic
938377722 2:130819562-130819584 GGGCTGAGCAGAGTACAGATGGG + Intergenic
942221238 2:173770856-173770878 ATTCTGTGCCAAGAACAGGTAGG + Intergenic
942715600 2:178888245-178888267 TAACTGAACCAAGTACAGATGGG - Intronic
945844562 2:214928897-214928919 ATGCTGACCTAGGTAAAGATGGG - Intergenic
1170516818 20:17138500-17138522 CTGGTGAGCCAAGTACAAAATGG - Intergenic
1173253281 20:41375700-41375722 TTGCTGAGACAAGGACAGAGGGG + Intergenic
1178476795 21:32944250-32944272 ATGCTGAGCCAGCTTGAGATTGG - Intergenic
1182754022 22:32664282-32664304 ATCATCAGCCAAGTACTGATTGG - Intronic
1183070699 22:35394034-35394056 AGGCTGAGCCAGGAACAGAGTGG - Exonic
1184138608 22:42564345-42564367 AGACAGACCCAAGTACAGATGGG - Intronic
1184941030 22:47765485-47765507 ATGATGAGCCAAGCACAGGGTGG - Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
952138954 3:30457167-30457189 ATGCTAAGCCAAATATAAATGGG - Intergenic
955278994 3:57575736-57575758 ATGCTGAGTAAAGTATATATAGG - Intronic
960737968 3:120801303-120801325 AGGCTGAGTCCTGTACAGATGGG + Intergenic
961365642 3:126397843-126397865 ATGCTGAGCCAAGTACAGATAGG + Intronic
961429445 3:126870866-126870888 ATGCTTTGCAAACTACAGATTGG - Intronic
964747793 3:160027983-160028005 ATGCTGAGTCATTTCCAGATTGG + Intronic
965899600 3:173622341-173622363 TTGCTGTGAGAAGTACAGATGGG + Intronic
966043804 3:175525938-175525960 ACGCTGAGCCAAGTTCCGTTGGG + Intronic
968980658 4:3847685-3847707 ATGGTGAGCCAGGCACAGAGTGG + Intergenic
975139507 4:70904865-70904887 ATACTGAGCCATGTAAAAATAGG - Intronic
975370250 4:73577738-73577760 ATGCTAAGCCAAGTTAACATTGG - Intronic
978183866 4:105835322-105835344 AGGGTGAGCCAGGTACAGAGTGG + Intronic
981765799 4:148248331-148248353 TTGCTGAGCCCAGTTCAGCTGGG + Intronic
982988340 4:162238828-162238850 ATGCTGAGAGAAGTACACTTTGG + Intergenic
985059459 4:186061920-186061942 ATGCTGAGCCAAGGACGGAGTGG + Intergenic
988714387 5:33810782-33810804 TTGTTGAGTCAAGTAAAGATAGG - Intronic
992974053 5:82094034-82094056 ATCTTCAGCTAAGTACAGATCGG - Intronic
993822393 5:92634719-92634741 ATGTTTTGCCAAGTACAAATAGG - Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
995597697 5:113765287-113765309 AGGCTGACCCAAGTTCAGTTTGG + Intergenic
997641530 5:135451813-135451835 AGGCTGAGCCCAGGACAGGTGGG + Intronic
1000148365 5:158475386-158475408 ATCCTTACCAAAGTACAGATGGG - Intergenic
1009582670 6:65557276-65557298 AGGCTGAGCCAGGTGCAGAGTGG + Intronic
1013574673 6:111469899-111469921 AAGCTGATCCAAGTAGAGAGGGG + Intronic
1016778287 6:147930229-147930251 ATGCTGATAGAAATACAGATAGG - Intergenic
1017547230 6:155465606-155465628 CTGAAGTGCCAAGTACAGATTGG - Intergenic
1020389356 7:7641615-7641637 AAGATGAGCCAGGGACAGATTGG - Intronic
1022696296 7:32708986-32709008 ATGATGAGTGATGTACAGATGGG - Intergenic
1022712624 7:32865737-32865759 AAGATGAGCCAAGTGCTGATAGG - Intergenic
1023816055 7:43950810-43950832 ATGCTGAGCCATGTGCACAGAGG + Intronic
1024019952 7:45359690-45359712 ATGCAGAGCCAAGGACAGGGCGG + Intergenic
1027834412 7:83221950-83221972 ATGCTGATTGAAGTACAAATTGG + Intergenic
1028239287 7:88399502-88399524 ATGGTGAGCAAAGTGCAGAGGGG + Intergenic
1031981166 7:128126351-128126373 ATGCTGTGCCCAGTATATATTGG - Intergenic
1032866920 7:135935165-135935187 ATGGAGAACCAAGGACAGATGGG - Intronic
1033662306 7:143410488-143410510 AGTCTGAGCCAAGAACTGATGGG - Intergenic
1033793573 7:144820808-144820830 ATGCTGAGATAGGTACAGAGAGG - Intronic
1041148173 8:54902069-54902091 ATGCAGACACAAGGACAGATAGG + Intergenic
1042926853 8:73975984-73976006 CCGCTGAGCCAAGGACAGAGCGG + Intronic
1043617959 8:82150863-82150885 ATGCCACGGCAAGTACAGATAGG - Intergenic
1044857221 8:96488788-96488810 ATGCTAAGCCAGGTATAGAATGG + Intergenic
1045777338 8:105821522-105821544 ATTCTGAGCCACCTAAAGATGGG + Intergenic
1046274997 8:111947275-111947297 ATGCTTAGTCAAGTTCAGTTAGG + Intergenic
1049529061 8:143144726-143144748 GCGCTGAGCCAAGTACACAAGGG - Intergenic
1050948059 9:11550592-11550614 AGGCTGAGCCAAGCACGGAGTGG - Intergenic
1052437298 9:28444834-28444856 AGGCTGAGCCAGGTGCAGAGTGG - Intronic
1053154740 9:35769153-35769175 GTGCTGAGGCAGGTACACATGGG - Intergenic
1053727352 9:41017528-41017550 ATACTGTGCCCAGTACAGAGAGG - Intergenic
1054701163 9:68414584-68414606 ATACTGTGCCCAGTACAGAGAGG + Intronic
1062501319 9:136853207-136853229 GTGGTGAGCCAAGACCAGATGGG + Exonic
1189024618 X:37379850-37379872 ATGCTGTGACAAATGCAGATAGG + Intronic
1193916764 X:87374500-87374522 ATAGGGAGCAAAGTACAGATAGG - Intergenic