ID: 961368948

View in Genome Browser
Species Human (GRCh38)
Location 3:126418096-126418118
Sequence CCTTCTAGCCAGGACCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961368948_961368958 20 Left 961368948 3:126418096-126418118 CCATTCAGGTCCTGGCTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 961368958 3:126418139-126418161 CTGGGTGAAATTTCCCAGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 193
961368948_961368959 21 Left 961368948 3:126418096-126418118 CCATTCAGGTCCTGGCTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 961368959 3:126418140-126418162 TGGGTGAAATTTCCCAGGTGGGG 0: 1
1: 0
2: 2
3: 26
4: 274
961368948_961368956 16 Left 961368948 3:126418096-126418118 CCATTCAGGTCCTGGCTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 961368956 3:126418135-126418157 CCAGCTGGGTGAAATTTCCCAGG 0: 1
1: 0
2: 2
3: 16
4: 159
961368948_961368957 19 Left 961368948 3:126418096-126418118 CCATTCAGGTCCTGGCTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 961368957 3:126418138-126418160 GCTGGGTGAAATTTCCCAGGTGG 0: 1
1: 0
2: 0
3: 21
4: 182
961368948_961368953 1 Left 961368948 3:126418096-126418118 CCATTCAGGTCCTGGCTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 961368953 3:126418120-126418142 CTGTGGCTATTAAGTCCAGCTGG 0: 1
1: 0
2: 2
3: 5
4: 84
961368948_961368954 2 Left 961368948 3:126418096-126418118 CCATTCAGGTCCTGGCTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 961368954 3:126418121-126418143 TGTGGCTATTAAGTCCAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961368948 Original CRISPR CCTTCTAGCCAGGACCTGAA TGG (reversed) Intronic
901192059 1:7418523-7418545 TCTTGTCCCCAGGACCTGAAAGG + Intronic
901402712 1:9025569-9025591 CCTTTGAGCCGGGACCAGAATGG + Intronic
905371999 1:37487289-37487311 CCTTCCAGCTAGTTCCTGAAGGG + Intergenic
906157643 1:43623149-43623171 CCCACTGGCCTGGACCTGAAAGG - Exonic
907158238 1:52353633-52353655 CCTTCCATCCAGGACCTGTGAGG + Exonic
907306314 1:53514967-53514989 CCCTTTAGCCAGGGCCTGCAAGG - Intronic
914351642 1:146845061-146845083 CCTTTTAGCCATGACCAGAGTGG + Intergenic
918784528 1:188748703-188748725 CCTTTTAGCCAGGACTGGACTGG - Intergenic
920292995 1:204937049-204937071 CCATCTGACCAAGACCTGAATGG - Intronic
1064790981 10:18957999-18958021 CCCTATAGCCAGGTCCTGAATGG - Intergenic
1065367546 10:24951155-24951177 CCTTTGAGCCAAGATCTGAAGGG - Intronic
1066178634 10:32938151-32938173 CCTTTTAGACAGGCCTTGAAAGG - Intronic
1067208880 10:44242227-44242249 CCTCCTACCCAGGACTTGAAGGG + Intergenic
1067474920 10:46558540-46558562 CCTCCTTGCCAGGGCATGAATGG - Intergenic
1068594786 10:58891003-58891025 CCATCTAACCAGAACCTCAAGGG - Intergenic
1071682071 10:87716377-87716399 CTTTCTGGCCACGAGCTGAATGG + Intronic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1074340941 10:112629295-112629317 CCTTATGACCAGGCCCTGAAGGG + Intronic
1078097526 11:8309845-8309867 CCTACTGGCCAGGACCAGATAGG + Intergenic
1078722589 11:13898107-13898129 CCTGCCAGCCAGGCCCTGCAAGG - Intergenic
1081050427 11:38333266-38333288 CCTTGTAGCCATGTCATGAAGGG - Intergenic
1082692912 11:56326990-56327012 CCTTTTAGCCATGACTAGAATGG - Intergenic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1089772943 11:120816340-120816362 CCTTCCAGCCAGGTCCTTAGGGG + Intronic
1091555943 12:1573611-1573633 CATTCAAGCCAGGACTTAAAGGG + Intronic
1099688014 12:85913910-85913932 CCTTCCAGCCATCACCTGAAAGG - Intergenic
1100811641 12:98344766-98344788 TGTTCTATCCAGGCCCTGAATGG - Intergenic
1103333818 12:120174112-120174134 CCTTCCAGTCAGGTCCTGAATGG - Exonic
1106004474 13:25756048-25756070 CCTTAAAGCCAGGAGCTGAGAGG + Intronic
1110965165 13:81685613-81685635 CTTTCTATCCAGGACCTGTGAGG + Intergenic
1116812489 14:49552842-49552864 CCTCCCAGCCATGACCAGAAAGG + Intergenic
1117086387 14:52206190-52206212 TCTTCCAGCCAGGTCCTGACAGG + Intergenic
1117263224 14:54058293-54058315 CCTTCTAGCAGGGAGCTAAAAGG + Intergenic
1117318275 14:54596116-54596138 CTTTCCTGCCAGGACCTGACGGG - Intronic
1120827179 14:88966637-88966659 CCTTCTAGCAAGGACTTCCACGG - Intergenic
1122248749 14:100423465-100423487 CCTTTGTGCCAGGATCTGAAGGG - Intronic
1125933421 15:43615899-43615921 CCTGCTAGCCAAGGCCAGAAGGG + Exonic
1125946519 15:43715361-43715383 CCTGCTAGCCAAGGCCAGAAGGG + Intergenic
1127275394 15:57439006-57439028 CCTTCCTGCCAGGAACTGGACGG + Exonic
1129311833 15:74718243-74718265 CCACATAGCCAGGAGCTGAAGGG - Intergenic
1133242949 16:4426402-4426424 CCTTCTAGCCCGTAGCGGAAGGG + Intronic
1134776128 16:16855202-16855224 CCTTCTAGACAGGATCTGGCTGG + Intergenic
1137788154 16:51153471-51153493 CGTTCTCGCCAGGTCCTGATGGG + Intergenic
1138083960 16:54116841-54116863 CCTTCTAGCCGGGATCTGGGGGG - Exonic
1138490676 16:57374429-57374451 CTTTCTTGCCAGGACTTGAGTGG - Intronic
1139982392 16:70870474-70870496 CCTTTTAGCCATGACCAGAGTGG - Intronic
1141254479 16:82387831-82387853 CCTTCAAGCCACAACCTCAAAGG - Intergenic
1146063480 17:29618837-29618859 CCTGCTAGCCACCACCTGCAAGG - Exonic
1146514181 17:33476151-33476173 CATTCTAGCAAGGACCTAACCGG + Intronic
1148602030 17:48901480-48901502 CCTGCAAGTCAGGGCCTGAAGGG - Intergenic
1150827518 17:68490160-68490182 CCTGTTAGCCTGGAGCTGAAGGG - Intergenic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1154087643 18:11322863-11322885 ACTACGAGCCAGGGCCTGAAGGG + Intergenic
1158115478 18:53990814-53990836 CCTTCATCCCAAGACCTGAAAGG + Intergenic
1158944468 18:62436692-62436714 CCTCCTAGCCAAGCCCTGAAGGG - Intergenic
1160942160 19:1625447-1625469 ACGTCCAGCCAGGACCTGGAAGG + Intronic
1162954772 19:14091581-14091603 ACTTCAAGCCAGGACCTGATCGG + Intergenic
1166178785 19:41092685-41092707 TCTGCTAACCAGGACATGAACGG - Intronic
1167510380 19:49892697-49892719 CCTTCTGGCCAGGACCTCAGAGG + Intronic
925475673 2:4211475-4211497 AGTTCTTGCCAGGAGCTGAAGGG - Intergenic
929437682 2:41940731-41940753 CCTTCAGACCAGGCCCTGAAGGG - Intronic
930436203 2:51346388-51346410 CGTTCTAGCCAGAAGCTGAGTGG - Intergenic
932460028 2:71876078-71876100 CCTCCCAGCCAGAACCTGCAGGG + Intergenic
933798726 2:85942672-85942694 CCTTTTAGCCACGACTGGAATGG + Intergenic
935804430 2:106731908-106731930 TGTTCTAGCCAGGACCTTCAAGG - Intergenic
936825882 2:116580529-116580551 CCTTCTAGCCATGCCCCGGAGGG - Intergenic
941385042 2:164841803-164841825 CTCTCAAGCCAGGACTTGAATGG + Intronic
941552457 2:166934289-166934311 CCATGTAGCAAGGAACTGAAGGG + Intronic
942762075 2:179411443-179411465 CTTTCTAGACAGGACTTGTAAGG + Intergenic
945764643 2:213959837-213959859 TCTTCTAGAAAAGACCTGAATGG - Intronic
947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG + Intronic
948981944 2:241498942-241498964 CCTTCTAGACAGGACGTGGAGGG - Intronic
1171296860 20:24024731-24024753 CCTTCTTTCCAGGATGTGAAGGG + Intergenic
1172244706 20:33437965-33437987 CCTTCCAGCCAGGATCAGAGAGG - Intronic
1178805302 21:35834326-35834348 CCTCCTGGCCAGGATGTGAAGGG + Intronic
1180671608 22:17557912-17557934 CCTTCTGGCCAGTACTGGAAAGG + Intronic
1181790248 22:25259802-25259824 CCTTCTAGCCAGGATCTAATAGG + Intergenic
1181826061 22:25516813-25516835 CCTTCTAGCCAGGCTCTAATAGG + Intergenic
1183149645 22:36028095-36028117 CCTTCCAACCAGGCCCCGAATGG + Intronic
1183195254 22:36349241-36349263 ACTTATAGCCAGGACCTAAGCGG + Exonic
1184675070 22:46037115-46037137 CCCTCTGCCCAGGATCTGAATGG + Intergenic
1184916239 22:47570937-47570959 CCTTCTAGCCTGGAGCTGACAGG - Intergenic
951284176 3:20789170-20789192 CCTTCTTCCAAGGCCCTGAAAGG - Intergenic
953981508 3:47415505-47415527 CCATGTAGCCTGGAGCTGAAGGG + Intronic
954142957 3:48619785-48619807 CCTTCTTCCCAGGCCCTGCAAGG - Intergenic
958108124 3:89104120-89104142 CATTCAAGCCAGGAATTGAAAGG + Intergenic
961368948 3:126418096-126418118 CCTTCTAGCCAGGACCTGAATGG - Intronic
963686961 3:148447868-148447890 ACTCATAACCAGGACCTGAAGGG - Intergenic
964094791 3:152918726-152918748 CCTTCTACCCTTGACCTTAAAGG + Intergenic
970032656 4:11694372-11694394 TCTTGTAGCCTGGGCCTGAAAGG - Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
975845610 4:78522206-78522228 CCTTCTACCAAGGACTTCAATGG + Intronic
984527796 4:180877152-180877174 GGATCTAGCCATGACCTGAAGGG - Intergenic
985922369 5:2987565-2987587 TCTTCTATTCAGGACCTGAATGG - Intergenic
986030819 5:3890980-3891002 CCTGCACCCCAGGACCTGAAGGG - Intergenic
993526169 5:88968391-88968413 CCTCCTAAACAAGACCTGAAAGG - Intergenic
993760985 5:91797030-91797052 CCTACTAGCCATATCCTGAATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997388084 5:133489490-133489512 CCTTCTAGATAGTACCTCAAAGG - Intronic
998127759 5:139635825-139635847 CATTCTAGACAGGACCTTTAGGG + Intergenic
1005917428 6:30365522-30365544 CCTTCTAGCCTGGGAATGAAAGG + Intergenic
1012030107 6:94049049-94049071 CCTTTTATCCCTGACCTGAATGG - Intergenic
1015852428 6:137588379-137588401 TCTTCTAGCTAGGATCTCAAAGG - Intergenic
1016843604 6:148548551-148548573 CCATGTAGCCAGGCCCGGAATGG + Exonic
1018186122 6:161266271-161266293 CCTCCTGGCCAGGGCCTCAAGGG - Intronic
1021995913 7:26178363-26178385 CCTGCTAGCAAGGTCCTGGAAGG - Intronic
1022181668 7:27926382-27926404 AGTGCGAGCCAGGACCTGAATGG - Intronic
1023577755 7:41647535-41647557 CATTTTAGCCAGGACCTTCAGGG + Intergenic
1024294485 7:47831590-47831612 CGTTCTATTCAGGACCTCAAGGG - Intronic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024654148 7:51434878-51434900 CCTCCCGGCCAGGTCCTGAAGGG - Intergenic
1039571766 8:38592697-38592719 CCTTCTGGCCAGAACCTGGGGGG + Intergenic
1041463512 8:58137090-58137112 CCTTTTAGCCAGAAACTGCATGG + Intronic
1043416066 8:80051376-80051398 CCTTCAAACCAGTACCTGGAAGG - Intronic
1048545435 8:135382257-135382279 GATTCTAGCCAGGGCATGAAGGG + Intergenic
1050214666 9:3309314-3309336 CCTTCTAGGAAGAACCTGTAGGG + Intronic
1050716243 9:8529684-8529706 TCTTCTAGCCAGGATTAGAAAGG + Intronic
1055183193 9:73415559-73415581 TTTTCTAGCCATGACATGAAAGG - Intergenic
1057247500 9:93469104-93469126 CTTTCTAACCAAGACCTGAAAGG - Intronic
1058446482 9:105059763-105059785 ACTGGTATCCAGGACCTGAAAGG - Intergenic
1060928782 9:127474776-127474798 GCTTGTCGCCAGGACCTGACAGG - Intronic
1061948121 9:133920187-133920209 CCTTCTAGTCAGCCCCAGAAAGG + Intronic
1062581596 9:137231388-137231410 CCTTCCAGTCAGGACCAGCAAGG + Intronic
1195085865 X:101413219-101413241 CCTGCTAGCCAGCAGCTGAGTGG + Exonic