ID: 961372736

View in Genome Browser
Species Human (GRCh38)
Location 3:126441294-126441316
Sequence TTCTATGCTGAAGGTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372736_961372745 17 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372736_961372747 19 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372736_961372743 2 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372736_961372748 22 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372736_961372746 18 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372736 Original CRISPR TTCTATGCTGAAGGTGGTGG GGG (reversed) Intronic
900239296 1:1607021-1607043 TTCTCTGCTCCAGGTGGAGGGGG - Intergenic
900785471 1:4647037-4647059 TTTGATGGTGATGGTGGTGGTGG + Intergenic
900981586 1:6049036-6049058 TTCTATGCTGGGAGGGGTGGTGG - Intronic
901339572 1:8483761-8483783 TTCTTTGCTGAAGGAGATGTGGG + Intronic
902796151 1:18801544-18801566 TGTTATGCTGATGGTGGTGTTGG - Intergenic
902796192 1:18801900-18801922 TGTTATGCTGATGGTGGTGTTGG - Intergenic
902796196 1:18801935-18801957 TGTTATGCTGATGGTGGTGTTGG - Intergenic
906198535 1:43945002-43945024 TTCACTGGTGGAGGTGGTGGTGG - Intergenic
907789399 1:57647275-57647297 TGCATTGCTGAAGGTAGTGGAGG - Intronic
908319895 1:62968968-62968990 TTCTGTGCTGAATGTGCTGGGGG - Intergenic
910127086 1:83854734-83854756 TTCTGTGCTGGAGGTGGTGAAGG - Intergenic
910784506 1:90980460-90980482 TTTTATTCTGAAAGTGATGGGGG + Intronic
913131600 1:115842675-115842697 TTGTATGATGAAGGGGGAGGAGG - Exonic
913656347 1:120963984-120964006 TGCCATGCTGAAGCTTGTGGTGG - Intergenic
916345752 1:163789492-163789514 TTCTGTGGTGAAGGTGCTGAAGG + Intergenic
917719879 1:177777332-177777354 TCCTATTCTGATGGTGGTAGTGG - Intergenic
920275394 1:204800701-204800723 GTCCAGGATGAAGGTGGTGGTGG + Intergenic
920423773 1:205856759-205856781 TTCTATGCTGACTTTGCTGGTGG - Intergenic
920437031 1:205953671-205953693 TCCTCTGGTGAAGGGGGTGGGGG + Intergenic
921953899 1:220961899-220961921 TTCTTTGTTGAAGGGGTTGGGGG + Intergenic
922603139 1:226871814-226871836 TTCTCTCCTGAATGTGGTTGTGG + Intronic
922900130 1:229130172-229130194 TTCTGAGCTGCTGGTGGTGGGGG + Intergenic
923648277 1:235846125-235846147 TTTTCTGGTGCAGGTGGTGGAGG - Intronic
923681766 1:236124285-236124307 TTCCATGCAGAAGGGGGTGAAGG + Intergenic
924567204 1:245208766-245208788 TGAGATGCTGAAGGAGGTGGTGG - Intronic
924647625 1:245893749-245893771 CTCTATCTTGATGGTGGTGGTGG + Intronic
1062938982 10:1407744-1407766 TTCCATCCTGGAGGTGGGGGAGG - Intronic
1063288328 10:4713778-4713800 TTCTTTCCTGAAGGTGGAAGGGG + Intergenic
1063583121 10:7327296-7327318 CTGTATCCTGATGGTGGTGGTGG - Intronic
1064960853 10:20963680-20963702 TTCTAGGCTGGGTGTGGTGGTGG - Intronic
1065615522 10:27517778-27517800 TGGTATGCTGACTGTGGTGGTGG - Intronic
1066984799 10:42455262-42455284 TTTTATGGAGAAGGAGGTGGAGG - Intergenic
1067370494 10:45677905-45677927 TTTTATGGAGAAGGAGGTGGAGG + Intergenic
1067389286 10:45848251-45848273 TTTTATGGAGAAGGAGGTGGAGG - Intronic
1067416784 10:46108707-46108729 TTTTATGGAGAAGGAGGTGGAGG + Intergenic
1067444970 10:46336298-46336320 TTTTATGGAGAAGGAGGTGGAGG + Intergenic
1067502183 10:46815590-46815612 TTTTATGGAGAAGGAGGTGGAGG + Intergenic
1067592402 10:47524430-47524452 TTTTATGGAGAAGGAGGTGGAGG - Intronic
1067632903 10:47979342-47979364 GTCTATTCTGTTGGTGGTGGTGG - Intergenic
1067639518 10:48032503-48032525 TTTTATGGAGAAGGAGGTGGAGG - Intergenic
1067873977 10:49987802-49987824 TTTTATGGAGAAGGAGGTGGAGG + Intronic
1068604306 10:58988724-58988746 CTCTGTGCTGATGGTGGTAGTGG + Intergenic
1068722304 10:60259355-60259377 TTCTGAGCTGAAGGCTGTGGTGG - Intronic
1069101985 10:64333613-64333635 TTATATGTTGATGGAGGTGGTGG + Intergenic
1069108679 10:64415659-64415681 AGCAATGCTGAAGGTGGTGGAGG + Intergenic
1070136503 10:73698653-73698675 TTTTATGGAGAAGGAGGTGGAGG - Intergenic
1070464972 10:76712082-76712104 TGCTCTGGTGGAGGTGGTGGGGG - Intergenic
1070503632 10:77094329-77094351 CACTAAGATGAAGGTGGTGGTGG + Intronic
1070667969 10:78358756-78358778 TTCCCTGCAGAAGGTGGTGGTGG + Intergenic
1070748846 10:78951952-78951974 TTCAAGGCTGCAGGGGGTGGGGG - Intergenic
1070812732 10:79306413-79306435 TTCTGTGCTGATGGTGGCAGGGG + Intronic
1071054137 10:81489523-81489545 GTGGTTGCTGAAGGTGGTGGTGG - Intergenic
1076193549 10:128499367-128499389 CTCTTTGCTGAAGGTCGTTGGGG - Intergenic
1077095007 11:795548-795570 CTCTGTGCTGAAGGATGTGGGGG - Intronic
1077153953 11:1083299-1083321 TCCTCTGCTGGAGGGGGTGGTGG + Intergenic
1077832199 11:5885458-5885480 AACTATGCTGAAGGTTGAGGTGG + Intronic
1078096869 11:8303815-8303837 TCCCATGCTGCTGGTGGTGGTGG + Intergenic
1079990594 11:27242439-27242461 TTCTGTGCTGGCAGTGGTGGTGG + Intergenic
1082989002 11:59191364-59191386 CACTATGCTGAAGGGGGAGGCGG - Intronic
1083520037 11:63301160-63301182 TCCTATGGTGAAGTTGGTGTAGG + Intronic
1083751923 11:64765822-64765844 TTCTGTGGTGGAGGCGGTGGGGG + Intronic
1084740825 11:71138428-71138450 TTAAATCCTGAAGGTGGAGGAGG + Intronic
1085260242 11:75200381-75200403 TCCTAAGGTGAAGGTGGGGGTGG + Exonic
1086856384 11:91871288-91871310 TTCTAAGCCTAAGGTAGTGGTGG - Intergenic
1089609068 11:119659473-119659495 TGCTCTGCTGAGGGTGGTGCTGG + Intronic
1090647655 11:128778691-128778713 GGCCATGATGAAGGTGGTGGTGG - Intronic
1090753082 11:129764248-129764270 TGCTGTGGTGGAGGTGGTGGGGG - Intergenic
1091321933 11:134657783-134657805 TTCCATGCTGGAGGTGCTGGGGG + Intergenic
1092202111 12:6591966-6591988 GTCTCTGCTGAATGTGGTGATGG - Exonic
1093543366 12:20315562-20315584 TCCCATGATGATGGTGGTGGTGG + Intergenic
1094472242 12:30814126-30814148 TTCTATGTTGATGGTGGTGGTGG - Intergenic
1095092299 12:38118614-38118636 TGGTATGATGATGGTGGTGGTGG + Intergenic
1095284647 12:40393984-40394006 GTGGCTGCTGAAGGTGGTGGGGG + Intronic
1095305141 12:40629624-40629646 TTCGTTGTTGATGGTGGTGGTGG - Intergenic
1095484093 12:42666207-42666229 CTGTATCCTGAATGTGGTGGTGG - Intergenic
1097547064 12:61016744-61016766 TGTTATGTTGATGGTGGTGGTGG - Intergenic
1097760596 12:63459781-63459803 TGCTCTGGTGGAGGTGGTGGGGG - Intergenic
1098961107 12:76740401-76740423 TTGTATGCTTGTGGTGGTGGTGG + Intergenic
1099693939 12:85994551-85994573 TTCTATGTTTGAGGTGGGGGAGG - Intronic
1101055343 12:100906759-100906781 TTCAAGGCTGAAGGTGTTTGGGG + Intronic
1102013649 12:109634251-109634273 TGCTGTGGTGATGGTGGTGGTGG - Intergenic
1103535682 12:121632289-121632311 TTCTATGATGACGGTGGTGGTGG + Intronic
1104064303 12:125294125-125294147 GTCTATGCTCACAGTGGTGGAGG - Intronic
1104375421 12:128261907-128261929 TGATATGATGATGGTGGTGGTGG + Intergenic
1104541871 12:129673086-129673108 TTCTATCCTGACTGTGGTAGTGG - Intronic
1105229710 13:18480715-18480737 TTCAGTGCTGAGTGTGGTGGAGG - Intergenic
1106515278 13:30448024-30448046 TTTTATGCTGGAGGTGTTGTGGG + Intergenic
1107651483 13:42549616-42549638 TTCTCTTCTGAAGGTGTGGGAGG + Intergenic
1107655160 13:42585477-42585499 TTCTGTGCTAAAGGGGGTGGGGG - Intronic
1107665429 13:42684222-42684244 TTCTGTGGTGGTGGTGGTGGTGG - Intergenic
1107674587 13:42781570-42781592 TTATATGCTGGTGGTGGTGGTGG - Exonic
1108290696 13:48957568-48957590 ATCTACGATGGAGGTGGTGGGGG + Intergenic
1108678875 13:52762443-52762465 TGCTATGGTGAAGTTGGGGGAGG + Intergenic
1108859538 13:54838139-54838161 TTCTCTGGGGAAGGTAGTGGAGG - Intergenic
1110046132 13:70833822-70833844 TTATGTGTTGATGGTGGTGGTGG + Intergenic
1110329305 13:74252482-74252504 TGATATGCTGAAGGTTGTAGAGG - Intergenic
1110873091 13:80475230-80475252 TTTTAAAATGAAGGTGGTGGTGG + Intergenic
1111420297 13:88001474-88001496 TTCTATGCTTAAGTTGTTGAGGG + Intergenic
1111644983 13:91021519-91021541 GTCTGTGGTGATGGTGGTGGGGG - Intergenic
1111656741 13:91163347-91163369 TTCTATGTTGACTGTGGTGGTGG + Intergenic
1112330733 13:98475200-98475222 TGAAATACTGAAGGTGGTGGTGG - Intronic
1112697956 13:101971660-101971682 TTCTATGCTGAGGCTGGGTGTGG - Intronic
1113778635 13:112963177-112963199 TTCCCTGCTGAGAGTGGTGGAGG - Intronic
1114933612 14:27506578-27506600 TTGTGTGCTGCAGGTGGGGGTGG + Intergenic
1115675205 14:35665908-35665930 TTATCTGCTTAAGGAGGTGGGGG + Intronic
1116174979 14:41457133-41457155 TTATAAACTGAAGGTAGTGGGGG + Intergenic
1116330739 14:43594724-43594746 TTCTATGCCGAAGCTGATGAGGG + Intergenic
1116406375 14:44571632-44571654 TTCTATGCCGAATGTGCTGAGGG - Intergenic
1118289076 14:64504079-64504101 TTCTGGGGTGAAGGTGGGGGTGG + Exonic
1118901069 14:69986319-69986341 TTCTAGGCTGATGGTGGTGGTGG + Intronic
1119322379 14:73739605-73739627 TTCCATGTTGAATGGGGTGGAGG + Exonic
1119385578 14:74256348-74256370 TTGAATGCGGAAGGTGGAGGTGG + Intronic
1121218992 14:92271736-92271758 TTGCTTGCTGGAGGTGGTGGTGG + Intergenic
1121316245 14:92962597-92962619 TTCTATGGTGTGGGTGGAGGTGG + Intronic
1124018718 15:25901080-25901102 TGCAATGCTGAATGTGGAGGAGG + Intergenic
1124649403 15:31463786-31463808 TTCTGTGATGATGGTTGTGGTGG + Intergenic
1126767267 15:52021257-52021279 TACTTTGCTGAAGGGGATGGGGG + Intronic
1129384418 15:75188127-75188149 CTCTATGCTGAAGGGGCTGGGGG - Intergenic
1130047590 15:80457936-80457958 TTCGATGATGAAGATGGTGAAGG + Exonic
1130051389 15:80486821-80486843 TTCTAGGCTGTGGGTGGTGTGGG + Intronic
1130193713 15:81760065-81760087 TTCCATGCAGAAGCGGGTGGGGG - Intergenic
1130934048 15:88453918-88453940 TTTAGTGCTGAGGGTGGTGGGGG - Intergenic
1132416486 15:101623635-101623657 TTTTTTGCTGATGGTGGTGTTGG - Intronic
1133181384 16:4057395-4057417 TTCTAGGTTGATGGTGGTGATGG - Intronic
1133558598 16:6928858-6928880 TTCTGTGGTGATGATGGTGGTGG - Intronic
1133598662 16:7317946-7317968 TTTGATGCTGGAGGTGATGGTGG + Intronic
1133694637 16:8250226-8250248 TGCAATGCAGAAGGTGGAGGGGG + Intergenic
1134788495 16:16966467-16966489 TTTTATACTGAAGGTGGAGAAGG + Intergenic
1134839139 16:17387400-17387422 TTCCCTGCTGAGGGAGGTGGGGG - Intronic
1135072675 16:19365802-19365824 TTGTATTCTGATGATGGTGGTGG + Intergenic
1135190535 16:20350695-20350717 TTGGATGCTGATGGTGGTGGTGG - Exonic
1135256810 16:20947673-20947695 TTCTGTATTGATGGTGGTGGTGG + Intronic
1136608059 16:31349675-31349697 TTCTAAGCTGAGGGTGGGGGAGG - Intergenic
1139361919 16:66405122-66405144 TCCTCTGATGATGGTGGTGGTGG - Intergenic
1139704953 16:68734875-68734897 TTCTCTGGAGAAGGTGATGGTGG + Intergenic
1140585330 16:76284226-76284248 TCCTATGTTGTGGGTGGTGGTGG + Intronic
1142103708 16:88290857-88290879 TGCTGTCCTGAAGGTGGGGGTGG - Intergenic
1142300495 16:89255038-89255060 TTCTGTACTGAAGGGGCTGGAGG + Intergenic
1142310238 16:89307956-89307978 TTCTGAGATGAAGGTGATGGTGG - Intronic
1142310251 16:89308037-89308059 TTCTGAGATGAAGGTGATGGTGG - Intronic
1142721944 17:1782258-1782280 TTCTTTGCTGGGGTTGGTGGGGG + Intronic
1143217259 17:5234318-5234340 TGCTATGCTGGAGGTGGGGGTGG - Intronic
1145049096 17:19645972-19645994 TTCTATAGTGAAAGTGGAGGAGG - Intergenic
1146115225 17:30130978-30131000 TTATATTCTCAAGGTGGTGGTGG + Intronic
1148957229 17:51363877-51363899 TTCTTTGCTTCTGGTGGTGGTGG + Intergenic
1149239676 17:54634521-54634543 TTTCAGGCTGAAGATGGTGGAGG + Intergenic
1149423155 17:56530295-56530317 TTCTATTCCGAAGATGGTGGGGG + Intergenic
1149622293 17:58054911-58054933 CTCTAGGCTGAAGGTGTAGGTGG + Intergenic
1151481926 17:74374709-74374731 TTCTTTGCTTAAGGAGGAGGGGG + Intergenic
1152855795 17:82664051-82664073 TGCTGTGCCGACGGTGGTGGGGG + Intronic
1152855823 17:82664131-82664153 TGCTGTGCCGATGGTGGTGGTGG + Intronic
1152855897 17:82664333-82664355 TGCTGTGCCGACGGTGGTGGTGG + Intronic
1153504009 18:5777060-5777082 TTTTATCCTGAAGGGGGTGTTGG + Intergenic
1153917065 18:9755443-9755465 TTCTGTGCTGGAGGAGTTGGAGG + Intronic
1154523693 18:15259125-15259147 TTCAGTGCTGAGTGTGGTGGAGG + Intergenic
1155844575 18:30689476-30689498 TTAATTCCTGAAGGTGGTGGTGG - Intergenic
1156516682 18:37686132-37686154 TGTTATTTTGAAGGTGGTGGGGG + Intergenic
1159101389 18:63962844-63962866 TTCTGTGTTGAAGGAGATGGAGG + Intronic
1160339344 18:78074441-78074463 GTCTATGCAGAATGTGGCGGTGG + Intergenic
1162805968 19:13138285-13138307 TTCACTGATGAAGGTGGTGTAGG - Exonic
1163040092 19:14595688-14595710 TTGTGTGCTGATGGTGATGGTGG + Intronic
1163195388 19:15716067-15716089 TGGTATGCTCATGGTGGTGGTGG + Intergenic
1163218678 19:15898803-15898825 TGGTATGCTCATGGTGGTGGTGG - Intergenic
1165121386 19:33561102-33561124 TTCCAGGCTGAAGGAGCTGGAGG + Intergenic
1165748286 19:38244148-38244170 TAATATTCTGAAGATGGTGGTGG + Intronic
1166422609 19:42650595-42650617 TTTTAATGTGAAGGTGGTGGAGG + Intronic
1166971636 19:46572475-46572497 TTGAACGCTGAAGGTGGAGGTGG + Intronic
1167077467 19:47258161-47258183 TTCTATGGAGAAGATGGAGGTGG + Intronic
1167192808 19:48003487-48003509 TTGTATTCTAAAGGTGATGGAGG + Intronic
1167299103 19:48669118-48669140 TGATATGATGATGGTGGTGGTGG - Intronic
1167577323 19:50324023-50324045 TTCCAGGCAGAAGGTGGTGATGG + Exonic
1168527959 19:57103737-57103759 TTCTTTGCTGTTGGGGGTGGGGG + Intergenic
925328081 2:3038116-3038138 GGCACTGCTGAAGGTGGTGGGGG - Intergenic
928816441 2:35300540-35300562 TTCTAGGCTGAAGGCACTGGGGG - Intergenic
929140455 2:38662299-38662321 TTCTATGTTGAATGAGGAGGTGG + Intergenic
929213469 2:39384850-39384872 TTATTTCCTGATGGTGGTGGTGG - Intronic
930322020 2:49867363-49867385 TTGGCTGCTGAAGGTGGAGGTGG + Intergenic
930741229 2:54834813-54834835 TTCTATGTAAAAGATGGTGGTGG - Intronic
931225761 2:60328569-60328591 TTGTATCCTGAAGGTAATGGAGG + Intergenic
931514186 2:63032986-63033008 TTCTATGCTGATGCTGTTTGAGG + Intronic
932272787 2:70425498-70425520 TTCTATTCTGAGGGTGGGGTAGG + Intergenic
932488056 2:72097888-72097910 TTCTATCCTGATTGTGGTAGTGG - Intergenic
933616177 2:84484494-84484516 TTCTCTACTGGAGGTTGTGGGGG + Intergenic
935395193 2:102600564-102600586 TCCTAGGCTCAAGGTGCTGGTGG + Intergenic
935859027 2:107307551-107307573 GTATATGCTGAGGGTGGTGATGG - Intergenic
936507624 2:113120071-113120093 TTGTATGAAGAAGGAGGTGGAGG + Exonic
937100202 2:119262814-119262836 TTCTATGCTGAAGGTGTCTAAGG - Intronic
937524228 2:122747511-122747533 TTCTATGCTGAAGGAAGAGATGG - Intergenic
937993181 2:127675226-127675248 GTCAAGGCTGAGGGTGGTGGGGG + Intronic
938522998 2:132091982-132092004 TTCAGTGCTGAGTGTGGTGGAGG + Intergenic
938777951 2:134558691-134558713 TTCTTTGTTTAAGGTTGTGGAGG - Intronic
939640846 2:144638519-144638541 TGGGATGCTCAAGGTGGTGGGGG - Intergenic
941168615 2:162110247-162110269 TTTAATTCTGAAGTTGGTGGTGG + Intergenic
941169204 2:162117165-162117187 TTCCATTCTGAAAGTGGTTGAGG - Intergenic
942119193 2:172760170-172760192 GTCTTTGCTGATGGGGGTGGAGG - Intronic
942743469 2:179206089-179206111 TTTTATTGTGGAGGTGGTGGTGG - Intronic
943087300 2:183328136-183328158 TCAGAGGCTGAAGGTGGTGGCGG - Intergenic
943454629 2:188089630-188089652 TTCTATCCTGATTTTGGTGGGGG + Intergenic
944073321 2:195697576-195697598 TTCCATGGTGAAGGTGGGGAGGG - Intronic
945530129 2:210943068-210943090 TTATATCTTGATGGTGGTGGTGG + Intergenic
945864584 2:215161963-215161985 TGTTCTGGTGAAGGTGGTGGAGG - Intergenic
946520879 2:220463582-220463604 TTCCATTCTGGTGGTGGTGGAGG - Intergenic
949001602 2:241617725-241617747 TCCTCTGCTGTAGCTGGTGGAGG - Intronic
1168919636 20:1520588-1520610 CTCTATGCTGAGGTTGGTTGGGG + Intergenic
1169769334 20:9184160-9184182 ATCATTGCAGAAGGTGGTGGGGG - Intronic
1170123547 20:12936751-12936773 TTGTTTGGTGAAGGGGGTGGTGG - Intergenic
1170375829 20:15699462-15699484 TGTTCTGCTGGAGGTGGTGGAGG + Intronic
1171393185 20:24814666-24814688 TGCCAGGGTGAAGGTGGTGGGGG - Intergenic
1172110828 20:32544024-32544046 GGCTATGCTGAACGTGCTGGAGG + Intronic
1173048088 20:39531955-39531977 ATCTATGGTGATGGTGGTGTTGG + Intergenic
1174141573 20:48417904-48417926 TTGGATCCTGATGGTGGTGGTGG - Intergenic
1176773700 21:13109073-13109095 TTCAGTGCTGAGTGTGGTGGAGG - Intergenic
1177140568 21:17353370-17353392 TGCTCTGGTGGAGGTGGTGGGGG - Intergenic
1177148089 21:17428041-17428063 CTGTACGCTGAATGTGGTGGTGG + Intergenic
1177176519 21:17705360-17705382 TGCTCTGGTGGAGGTGGTGGGGG - Intergenic
1178666227 21:34549387-34549409 TTCTAACCTGAAGGTGGTTCAGG + Intronic
1178883632 21:36467592-36467614 TTCTTTGGTAAAGGCGGTGGTGG + Intronic
1179079602 21:38158683-38158705 GTCTATCCTGTAGGTAGTGGAGG - Intronic
1179905311 21:44419551-44419573 TGCGATGGTGATGGTGGTGGTGG + Intronic
1180039915 21:45270653-45270675 TGCTCTGCTGGAGGTGGCGGGGG - Intronic
1181447045 22:22985159-22985181 ATCTATGATGTGGGTGGTGGTGG + Intergenic
1181715608 22:24725217-24725239 ATCTGTGGTGGAGGTGGTGGAGG + Intronic
1181749359 22:24977992-24978014 TGCTATGATTACGGTGGTGGTGG - Intronic
1182236762 22:28882954-28882976 TTCGATCCTGGAGGTGGGGGTGG + Intergenic
1182686881 22:32128069-32128091 TTCTGTGCTGAATGTGGTGGGGG - Intergenic
1182714730 22:32348400-32348422 TTCTGTGCTGAGTCTGGTGGGGG + Intergenic
1183300967 22:37059013-37059035 GGCTAGGCTGGAGGTGGTGGTGG + Intronic
1183519535 22:38288692-38288714 TACTAGGCTGGAGGTGGTGCAGG - Intergenic
1184238466 22:43199217-43199239 TTTTCTGCTGGGGGTGGTGGAGG + Exonic
1184245677 22:43234720-43234742 TTGTGTGCGGAAGGTGGTGCTGG - Intronic
1184345203 22:43908895-43908917 TTCTATCCTGAGCATGGTGGAGG - Intergenic
1185287865 22:50010554-50010576 TTCTCTCCTGAAGGTGGATGCGG - Intronic
949504932 3:4718854-4718876 TTCTATGCTGAATTTGATGTTGG + Intronic
950124960 3:10505332-10505354 CTCAGTGCTGATGGTGGTGGCGG - Intronic
950526981 3:13529961-13529983 CTCCATCCTGAAGGTGGTGGGGG + Intergenic
950839158 3:15950149-15950171 ATCCATGGTGAAGGTGGTGGAGG - Intergenic
952006360 3:28846728-28846750 TGCGATGATGATGGTGGTGGTGG + Intergenic
953018749 3:39100654-39100676 TTCTATGGTGGAGATGGAGGAGG - Intronic
953727465 3:45412831-45412853 TGCCATATTGAAGGTGGTGGTGG - Intronic
953775599 3:45814206-45814228 CTCTATTCTGATTGTGGTGGTGG + Intergenic
954061890 3:48074814-48074836 TTTTAAGCTGAGTGTGGTGGTGG - Intronic
954638481 3:52084546-52084568 TTCTTTGCTGTCAGTGGTGGTGG - Intronic
955011007 3:55014226-55014248 ATTGATGGTGAAGGTGGTGGTGG + Intronic
955219438 3:57011567-57011589 TTCTTTGCTGTGGGTGGCGGGGG - Intronic
956786586 3:72647882-72647904 TTCTACTCTGATGTTGGTGGAGG - Intergenic
957034453 3:75281091-75281113 CCCTCTGCTGAAGGAGGTGGGGG - Intergenic
957254934 3:77824952-77824974 TTCTCTTCTGTAGGGGGTGGGGG + Intergenic
957435818 3:80175051-80175073 TTCTATGTTGATTGTGGTGGTGG + Intergenic
958881117 3:99671594-99671616 TACTATGGGGTAGGTGGTGGGGG - Intronic
959751729 3:109845063-109845085 AGCAATGATGAAGGTGGTGGTGG - Intergenic
961078364 3:124002993-124003015 CCCTCTGCTGAAGGAGGTGGGGG - Intergenic
961372736 3:126441294-126441316 TTCTATGCTGAAGGTGGTGGGGG - Intronic
961656644 3:128446025-128446047 GTTTATGGTGACGGTGGTGGTGG + Intergenic
962774463 3:138645984-138646006 TTCCATGCTGAATGTGGGAGTGG + Intergenic
963023539 3:140896746-140896768 TGCTCTGGTGAAGGTGGTGGGGG + Intergenic
963234868 3:142946792-142946814 TTGTATGCTAAACGTGGGGGGGG + Intergenic
966366198 3:179190311-179190333 TTTTATGCTGGGGGTGGTGGGGG - Intronic
968487421 4:870516-870538 TTCTCTGGTGTAGCTGGTGGTGG + Intronic
970312109 4:14793403-14793425 TGTTCTGCTGCAGGTGGTGGTGG - Intergenic
972736943 4:41851665-41851687 ATCTATGGTGGAGGTGGTGAAGG - Intergenic
973735435 4:53866634-53866656 TGCTAAGGTGAAGGTGGTGGTGG + Intronic
973744087 4:53946385-53946407 TTCTGTGTTGATGGTTGTGGTGG + Intronic
974860009 4:67508913-67508935 TTAAATGCTGAAGGTTCTGGAGG - Exonic
975674987 4:76818331-76818353 TCCAATGCTGAAAGTGGGGGTGG + Intergenic
976155253 4:82137348-82137370 TTTTCTGCTGAAGCTGGTGAAGG + Intergenic
976591737 4:86855844-86855866 TTTTATCCTGAAGGTGGAGCAGG - Intergenic
977294632 4:95197429-95197451 TGCTATGCTGAAGATGGAGGTGG + Intronic
978220469 4:106267651-106267673 TTTTTTGGTGATGGTGGTGGTGG - Intronic
980071404 4:128246276-128246298 ATATATGCTCAAGGTGGTAGGGG + Intergenic
981088527 4:140708772-140708794 TTCTATGGGTAAGGAGGTGGGGG + Intronic
981454724 4:144940269-144940291 ATCTAGGCAGAAAGTGGTGGTGG - Intergenic
985091645 4:186369196-186369218 TTCTCTGATGAAGGTGATGATGG + Intergenic
986669987 5:10134281-10134303 CTTTCTGCTGAAGATGGTGGAGG - Intergenic
988662928 5:33293312-33293334 TTTGCTGCTGATGGTGGTGGTGG - Intergenic
988696480 5:33626940-33626962 TGATTTGCTGATGGTGGTGGTGG + Intronic
988998171 5:36734316-36734338 GTGTGTGCTCAAGGTGGTGGAGG - Intergenic
991260554 5:64663120-64663142 TTCTAGGCTAGAGGTGGTGGAGG + Intergenic
992886136 5:81162182-81162204 TTCTTTGTTGGGGGTGGTGGGGG + Intronic
993047853 5:82888737-82888759 TTCCATTCTGGAGGTGCTGGTGG + Intergenic
995985389 5:118164671-118164693 TTCTTTGTTGAAATTGGTGGAGG + Intergenic
996398402 5:123035635-123035657 TTCGAAGCTGAAGCTGGAGGGGG - Intronic
997702832 5:135916365-135916387 TTATATGCTGAAGATGGTTGGGG + Intergenic
998164308 5:139834083-139834105 GTTTGTGGTGAAGGTGGTGGTGG - Intronic
998483886 5:142485288-142485310 TTTCATGATGGAGGTGGTGGTGG - Intergenic
998485245 5:142496510-142496532 TTATTTGTTGGAGGTGGTGGCGG + Intergenic
998785100 5:145700387-145700409 TTCCATGTTGAGAGTGGTGGGGG - Intronic
999326738 5:150648772-150648794 TTCTCTGGAGAAGGTGCTGGTGG - Exonic
1003640270 6:7869977-7869999 TCCTGTTCTGAGGGTGGTGGTGG - Intronic
1003742037 6:8951774-8951796 TTCTTTTCTAAAGGGGGTGGCGG - Intergenic
1004962006 6:20800621-20800643 TTCTTTTTTGAGGGTGGTGGGGG + Intronic
1005313070 6:24577530-24577552 TTCTACGTTAAAGATGGTGGTGG + Intronic
1006547765 6:34793284-34793306 TTCCATGCTGGAGTTGGTGATGG + Intronic
1007501324 6:42299902-42299924 TTCTCTACTGAAGATGGTGCAGG + Intronic
1008921905 6:56851270-56851292 ATCTGTGCTCAAGGTGGGGGAGG - Intronic
1010372955 6:75133319-75133341 GTTTATACTGAAGGTGATGGGGG - Exonic
1010449084 6:75982151-75982173 TTGTAGGATGAAGGTGGTGGTGG + Intronic
1011817778 6:91213208-91213230 TGCTCTGCTGAAGGTGGCAGGGG + Intergenic
1013495796 6:110696314-110696336 TTCTATGCTGATTTTGTTGGTGG - Intronic
1014406069 6:121052723-121052745 TTCCATGGTCATGGTGGTGGTGG + Intergenic
1014917059 6:127163379-127163401 TTCTATGAAGAAGCTGCTGGAGG - Intronic
1015442127 6:133260799-133260821 TTCTTTGCTGAATCTGATGGTGG + Intronic
1015950178 6:138545138-138545160 TTCTAGGCTGGGCGTGGTGGCGG - Intronic
1016172159 6:141031485-141031507 CACAATGCTGGAGGTGGTGGCGG + Intergenic
1016491846 6:144613671-144613693 CTATATGCTGATTGTGGTGGTGG + Intronic
1017125315 6:151059179-151059201 TTCTAAACTGGTGGTGGTGGTGG + Intronic
1017324418 6:153130285-153130307 TCCTTTGCTGTAGGTGATGGTGG - Intronic
1020049325 7:5071805-5071827 TTCCATGCTGAGGGTGGCAGAGG + Intronic
1021289672 7:18827489-18827511 TTCTATGCTGACAATGGAGGGGG - Intronic
1021512098 7:21444692-21444714 TCCTATGAAGAAGGTGGTGGTGG + Intronic
1023639027 7:42239081-42239103 TTTTATGGTGGAAGTGGTGGAGG + Intergenic
1024095784 7:45981345-45981367 TGCTGTGTTGAAGGTGGTGCCGG + Intergenic
1026828394 7:73597366-73597388 CTCTATGGGGAAGGGGGTGGGGG + Exonic
1027718732 7:81710548-81710570 TTTTATGTTGAGGGTGGTGAGGG - Intronic
1028673944 7:93436444-93436466 TTCTATGGCGGGGGTGGTGGAGG + Intronic
1029837169 7:103324991-103325013 CTCTAAGGGGAAGGTGGTGGTGG - Intronic
1030639302 7:111986012-111986034 TTCTCTGCTGGGAGTGGTGGTGG + Intronic
1030735240 7:113040342-113040364 ATCTATGCTTTTGGTGGTGGTGG - Intergenic
1030838415 7:114317550-114317572 TTCTAGGCAGGAGGTGATGGTGG - Intronic
1031446892 7:121865732-121865754 ATCTATAATAAAGGTGGTGGTGG + Intergenic
1037706465 8:21319620-21319642 TTCTATGATGGAGGTGGGTGTGG + Intergenic
1040636383 8:49278862-49278884 TTGGTTGCTGAAGGTTGTGGTGG - Intergenic
1042025271 8:64416215-64416237 GTCCATGCAGAAGGTGATGGTGG - Intergenic
1043969890 8:86517047-86517069 TTGTAGGCTGAAGGTAATGGTGG - Intronic
1045136781 8:99229423-99229445 TTCTTTGTTGAAGGTGGGGGTGG + Intronic
1045243136 8:100419735-100419757 TTTTCTGGTGAAGATGGTGGAGG + Intergenic
1045657876 8:104405817-104405839 ATCCATGCTGGAGGGGGTGGAGG + Intronic
1046848464 8:118945605-118945627 TTTTTTGGTGATGGTGGTGGTGG + Intronic
1047731741 8:127734412-127734434 TTCTCTTTTGGAGGTGGTGGAGG + Intergenic
1047755393 8:127914244-127914266 TTTTTTGCTGTTGGTGGTGGTGG - Intergenic
1049187634 8:141266405-141266427 TCCGAGGCTGATGGTGGTGGTGG - Intronic
1049317390 8:141976590-141976612 TTCCATTCTAAAGTTGGTGGTGG - Intergenic
1049417355 8:142501318-142501340 TTTGATGATGACGGTGGTGGTGG + Intronic
1049421846 8:142520350-142520372 TTGTATGATGATGGTGGTGATGG + Intronic
1049421856 8:142520427-142520449 TTGTATGATGATGGTGGTGATGG + Intronic
1050563485 9:6858361-6858383 GTCAATGTTGTAGGTGGTGGTGG - Intronic
1050615652 9:7399157-7399179 TTAGATTCTGTAGGTGGTGGGGG + Intergenic
1051875051 9:21783942-21783964 TTGTATGCTCAAGGTGGTAATGG + Intergenic
1053282155 9:36827368-36827390 TTATGTGGTGATGGTGGTGGTGG + Intergenic
1053701688 9:40699139-40699161 TTCAGTGCTGAGTGTGGTGGAGG + Intergenic
1054411753 9:64822594-64822616 TTCAGTGCTGAGTGTGGTGGAGG + Intergenic
1055200071 9:73648540-73648562 TTTTATGGAGAAGGAGGTGGAGG + Intergenic
1055902811 9:81260702-81260724 TTTTATGTTTAAGATGGTGGGGG - Intergenic
1057865329 9:98675603-98675625 GTCTATTCTGAAGGTGGGAGTGG + Intronic
1057907870 9:98996234-98996256 TTCTAAGCTAAAGGGGCTGGGGG - Intronic
1060673346 9:125490115-125490137 TCCTATGGTGGTGGTGGTGGTGG + Intronic
1061003394 9:127915350-127915372 TCCTAGGCTGAAGGGGCTGGTGG - Intronic
1061068500 9:128294237-128294259 TTTTATGGTGAAGGAGGAGGAGG + Intergenic
1061624886 9:131835758-131835780 TCCTCTGCTGAAGGAGGTGCTGG + Intergenic
1186223202 X:7371436-7371458 TTCTAGGCAGAAGGTGGTAGGGG + Intergenic
1186694927 X:12020221-12020243 TACTGTGCTGAAGGTTATGGGGG - Intergenic
1186871751 X:13780849-13780871 TTCTATTTTGAAGCTGATGGTGG + Intronic
1187239577 X:17500449-17500471 TTGTCTTCTGAAGGTTGTGGAGG + Intronic
1187294189 X:17983353-17983375 TTTTTTGCTGGAGGTGGAGGTGG - Intergenic
1188254965 X:27950448-27950470 GTCTATCCTGAAAGTAGTGGTGG - Intergenic
1190070491 X:47275344-47275366 TTCTCTGTTGAATGTGGTAGTGG - Intergenic
1190139283 X:47828159-47828181 CTGTATGCTGATGGTGGCGGTGG + Intergenic
1190782635 X:53612984-53613006 TTTTAAGGTGTAGGTGGTGGTGG - Intronic
1191828439 X:65390633-65390655 TCCCATGCTGAAGGTGGGGGTGG - Intronic
1192184508 X:68937759-68937781 TGTGATGCTGAAGGTGGTGATGG + Intergenic
1192191958 X:68996372-68996394 TTCTCTGCTGGAGGTGGGGCAGG - Intergenic
1192292103 X:69809051-69809073 TTTTAACCTGATGGTGGTGGTGG + Intronic
1193314567 X:80048938-80048960 TTCTATGCTGATTTTGGTGAGGG + Intergenic
1193493799 X:82185838-82185860 TTCCATGGTGGTGGTGGTGGTGG - Intergenic
1193636702 X:83959307-83959329 TTCTATGCTGATTTTGCTGGGGG - Intergenic
1194065327 X:89253626-89253648 GTCTATGGTGGTGGTGGTGGTGG + Intergenic
1194761025 X:97796032-97796054 TGCTTTGCCAAAGGTGGTGGTGG + Intergenic
1195201455 X:102554153-102554175 TTCTGTGCTGATGGTTGTTGTGG - Intergenic
1196039624 X:111188178-111188200 TTAAATGCTGAGGGTGCTGGAGG + Intronic
1196111081 X:111947863-111947885 TTCAATGCTGATGGTGGAGGGGG + Intronic
1196185771 X:112743542-112743564 TTCTTTGGTGATGGTGGGGGAGG - Intergenic
1198616490 X:138463598-138463620 TGCTTTGCTGGAGGTGGTAGGGG - Intergenic
1199174167 X:144765171-144765193 TTATATTCTCCAGGTGGTGGTGG + Intergenic
1199941637 X:152633345-152633367 TTCTGTGGTAATGGTGGTGGTGG + Intergenic