ID: 961372737

View in Genome Browser
Species Human (GRCh38)
Location 3:126441295-126441317
Sequence TTTCTATGCTGAAGGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372737_961372748 21 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372737_961372746 17 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372737_961372747 18 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372737_961372745 16 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372737_961372743 1 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372737_961372752 30 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372737 Original CRISPR TTTCTATGCTGAAGGTGGTG GGG (reversed) Intronic
901109246 1:6782431-6782453 TTTCAATGGTGATGGTGTTGAGG + Intergenic
901117199 1:6856778-6856800 TTTTTATGATGAAAGTGATGAGG + Intronic
901339571 1:8483760-8483782 ATTCTTTGCTGAAGGAGATGTGG + Intronic
902070000 1:13726284-13726306 TTTCCATGCTGGACGGGGTGAGG - Intronic
902566510 1:17315018-17315040 TTCCCATGCTGACGGGGGTGGGG - Intronic
903797792 1:25943108-25943130 TTCCTTTGCTGAAGGTGGACAGG - Intergenic
905142610 1:35860022-35860044 TGTCTAGGCTGAAGGTGCAGTGG + Intergenic
907001714 1:50866167-50866189 TTTCTATGCTGATTTTGCTGAGG - Intronic
907661046 1:56392710-56392732 TTTTTATTCTGAAGGAAGTGGGG - Intergenic
908319896 1:62968969-62968991 TTTCTGTGCTGAATGTGCTGGGG - Intergenic
909176498 1:72368462-72368484 TTTCTATCTTTAAGGTGCTGTGG + Intergenic
910359831 1:86404532-86404554 TTTCTAGGCTGAGGGTGGAGGGG + Intergenic
911036006 1:93548859-93548881 TTTCTATTCTGAATCTGGAGTGG - Intronic
913402582 1:118452959-118452981 TTTCTATGCTGATTTTGCTGAGG - Intergenic
913515870 1:119605308-119605330 TGTCTATGATGGAGGTGGTGTGG - Intergenic
913527561 1:119708756-119708778 TTTCTCTTCTGAAGGGGTTGGGG + Intronic
914959447 1:152193460-152193482 TTTCTCTGTTGATGGGGGTGAGG - Intergenic
915516160 1:156413806-156413828 TTTCTAGGCTCACGGTGTTGGGG + Intronic
916924924 1:169508523-169508545 TTTCTGTGCAGAAGGTGCTGAGG - Intergenic
918893153 1:190301936-190301958 TTTCTTTGCTGAAAGTGTTTTGG + Intronic
919440708 1:197629902-197629924 TATCTTTGCTGAGGTTGGTGAGG - Intronic
920280110 1:204836732-204836754 TTTCTATGCTGACGTAGGTCAGG + Intronic
920340501 1:205272529-205272551 TTTCTCTGGTGGAGATGGTGAGG + Exonic
922399761 1:225239949-225239971 ATTCTATGGTGATGGTGATGGGG - Intronic
1065962887 10:30748591-30748613 TTTCTGTATTGAAGGGGGTGGGG - Intergenic
1066372399 10:34828545-34828567 TTCCTTTCCTGAAGGTGGTGTGG + Intergenic
1068062974 10:52092537-52092559 ACTCTATGCTGAAGGGGGTAAGG - Intronic
1069228860 10:65980810-65980832 TTTCTATGCTGATTTTGCTGAGG - Intronic
1070464973 10:76712083-76712105 TTGCTCTGGTGGAGGTGGTGGGG - Intergenic
1070812731 10:79306412-79306434 TTTCTGTGCTGATGGTGGCAGGG + Intronic
1076663273 10:132069384-132069406 GTACTATCCTGATGGTGGTGGGG + Intergenic
1077095008 11:795549-795571 TCTCTGTGCTGAAGGATGTGGGG - Intronic
1078389129 11:10920526-10920548 TTTCTATTCTGAAAATGGAGGGG - Intergenic
1079355873 11:19730128-19730150 GTTCTATGGTGAATGTGTTGGGG + Intronic
1083202446 11:61128831-61128853 TTGCTCTGCTGGATGTGGTGAGG - Intergenic
1086018680 11:82199108-82199130 TTTGTATGTGGAAGGTGCTGGGG + Intergenic
1088235093 11:107714898-107714920 TGTATATGGTGATGGTGGTGGGG - Intronic
1089213822 11:116823535-116823557 CTTCCATGCTGAGGTTGGTGGGG - Intergenic
1089255840 11:117193502-117193524 TTTCCATGCAGAAGGGGCTGAGG + Intronic
1089501048 11:118931309-118931331 TATCGATGCTGAACTTGGTGTGG - Intronic
1090142953 11:124284895-124284917 TTTCAATGCTGAATATGTTGAGG - Intergenic
1090182218 11:124710079-124710101 TTTCAGTGCTGAAGGTAGAGGGG + Intergenic
1091321932 11:134657782-134657804 GTTCCATGCTGGAGGTGCTGGGG + Intergenic
1092995964 12:13950900-13950922 TTTCTATGTTGTAGGTGGCTAGG - Intronic
1094297087 12:28919213-28919235 TTTGTATGCTGAATTTGGTGAGG - Intergenic
1094336811 12:29366936-29366958 TTTCTATGCAGATGTTGGAGCGG - Exonic
1099928076 12:89041811-89041833 TTTCTATGAAGAAGGTGTAGTGG + Intergenic
1101562530 12:105871593-105871615 GTTCAATGCTGAAAGTGGCGTGG - Intergenic
1101655095 12:106713020-106713042 TTTTTGTGCGGAAGGTGGAGAGG - Intronic
1101718048 12:107328417-107328439 ATTCTATACTGAAAGTGGAGTGG + Intronic
1101962463 12:109260162-109260184 TTTCTTTGCTGGAAATGGTGGGG + Intronic
1104602833 12:130164465-130164487 TCTTTATGCTGCTGGTGGTGGGG + Exonic
1105539575 13:21303963-21303985 TTTGTATCCTGATTGTGGTGAGG - Intergenic
1105798762 13:23884268-23884290 TTTGTATCCTGATTGTGGTGAGG + Intronic
1105826162 13:24125459-24125481 TCTGTATGCTGAAGGAGGTGTGG - Intronic
1106335762 13:28781754-28781776 TTTCTATGCTGATTTTGCTGAGG + Intergenic
1106515277 13:30448023-30448045 TTTTTATGCTGGAGGTGTTGTGG + Intergenic
1106671962 13:31915510-31915532 TTCCTTTGGTGAAGCTGGTGAGG - Intergenic
1106920756 13:34560999-34561021 TTTCTATGCAGAAAGTGATGAGG + Intergenic
1107655161 13:42585478-42585500 GTTCTGTGCTAAAGGGGGTGGGG - Intronic
1108446809 13:50517662-50517684 TTTCTCTGCTGAAGTTAGTGAGG + Intronic
1109100075 13:58172569-58172591 TCACTCTGCTGAAAGTGGTGAGG + Intergenic
1110675041 13:78232405-78232427 ATTCTATGGTGAAGGTTGTAGGG - Intergenic
1111420296 13:88001473-88001495 CTTCTATGCTTAAGTTGTTGAGG + Intergenic
1111644984 13:91021520-91021542 TGTCTGTGGTGATGGTGGTGGGG - Intergenic
1111928813 13:94492336-94492358 CTTCTAAGTTGAAGGTGGTTGGG + Intergenic
1113298800 13:108993190-108993212 TTTATTTTCTTAAGGTGGTGTGG + Intronic
1114907942 14:27153658-27153680 TAACTAGGCTAAAGGTGGTGAGG - Intergenic
1116162643 14:41289073-41289095 TTGCTGTGCTGAAGGGGCTGAGG - Intergenic
1116324718 14:43517995-43518017 TTTCTATGCTGTTGCTGATGAGG - Intergenic
1116330738 14:43594723-43594745 CTTCTATGCCGAAGCTGATGAGG + Intergenic
1116406376 14:44571633-44571655 CTTCTATGCCGAATGTGCTGAGG - Intergenic
1118862676 14:69676921-69676943 TTATTATGGTGAAGGTGGTGAGG + Intronic
1118913346 14:70080255-70080277 TTGCTATGGTGATGGTGGGGAGG + Intronic
1119500255 14:75120569-75120591 TTTCTCTGCAGATGGTGGTGTGG - Exonic
1120380745 14:83775939-83775961 TTGCTATGGCGAAGGTGCTGTGG - Intergenic
1120576978 14:86194552-86194574 TTACAAAGCTGGAGGTGGTGAGG - Intergenic
1122416867 14:101554196-101554218 CTTCTTCGCTGAAGTTGGTGTGG + Intergenic
1124155426 15:27220819-27220841 TTTCCATGCCGAGGGTGGGGTGG + Intronic
1125500695 15:40238916-40238938 TTTCTTTGCTGAAGGGGAGGAGG - Intronic
1126274124 15:46856212-46856234 ATTTTATCCTGAAGGTGGTAAGG - Intergenic
1126322628 15:47442000-47442022 TGTATATGATGAAGGAGGTGTGG - Intronic
1126566241 15:50103061-50103083 TTTCTATGCTGATTTTGCTGAGG - Intronic
1126850424 15:52793563-52793585 TTTCTTTGCTGAACCTGGTAGGG - Intergenic
1127447610 15:59081197-59081219 TCTCTGTGCTGGAGGTGCTGTGG - Exonic
1129384419 15:75188128-75188150 ACTCTATGCTGAAGGGGCTGGGG - Intergenic
1130051388 15:80486820-80486842 CTTCTAGGCTGTGGGTGGTGTGG + Intronic
1131962773 15:97807074-97807096 TTTCTGTGCAGATGGGGGTGGGG - Intergenic
1133419184 16:5631165-5631187 TTGCTCTGATGAAGGTGATGAGG + Intergenic
1137655586 16:50154885-50154907 TGTCTATGCAGAGGGTGGCGTGG + Intronic
1137817516 16:51412948-51412970 TTTCTATGGTAATGGTGGTTTGG - Intergenic
1138011680 16:53386588-53386610 CTCCTTAGCTGAAGGTGGTGGGG + Intergenic
1140302897 16:73775388-73775410 TTTCTCAGCTGAGGGAGGTGGGG - Intergenic
1140906965 16:79417404-79417426 ATTCTATTTTGAAGGTGGAGGGG + Intergenic
1143362981 17:6386727-6386749 TTTCTATGCAAGAGGTTGTGGGG - Intergenic
1143813917 17:9495816-9495838 TTTCTAAGGGGAAGGTGGTATGG + Intronic
1143956046 17:10670031-10670053 TATGTATGTTGAAGGTGGGGAGG + Intergenic
1145785380 17:27590582-27590604 TCAATATGCTGAAGTTGGTGTGG - Intronic
1147413611 17:40272332-40272354 TTTCATTGGTGATGGTGGTGGGG + Intronic
1149423154 17:56530294-56530316 GTTCTATTCCGAAGATGGTGGGG + Intergenic
1152855885 17:82664291-82664313 GTGCTGTGCTGATGGTGGTGGGG + Intronic
1156496296 18:37527475-37527497 TTACTATTCTGGAGGGGGTGGGG - Intronic
1156516681 18:37686131-37686153 TTGTTATTTTGAAGGTGGTGGGG + Intergenic
1158978918 18:62739586-62739608 TTTCTATCCTGAAGGGAGAGAGG + Intronic
1159473909 18:68892347-68892369 TTTCCCTGCTTAAGGTGATGTGG + Intronic
1160463599 18:79057490-79057512 TTTCTTTGGTGCTGGTGGTGTGG + Intergenic
1162286662 19:9744010-9744032 TTTGTATGCTGGAGATGTTGTGG - Intergenic
1162799559 19:13103170-13103192 TGTCTGTGCTGATGGGGGTGAGG + Intergenic
1163645783 19:18488311-18488333 GTTCTATGCTGCTGGTGGGGAGG - Intronic
926887276 2:17609797-17609819 TTCATATGCTGTAGGTGATGGGG + Intronic
927687094 2:25178675-25178697 TGTCTTTGCTGAAGATGTTGTGG + Intergenic
930386258 2:50699290-50699312 CTTCTTTGCTGGTGGTGGTGAGG - Intronic
930620093 2:53634754-53634776 CTTCTAGGCTGAAGGCTGTGGGG - Intronic
933616176 2:84484493-84484515 TTTCTCTACTGGAGGTTGTGGGG + Intergenic
933878945 2:86648562-86648584 TTTTTATGCTGATGGAGATGTGG + Intronic
935562552 2:104574206-104574228 GTTTTATGCTGAGGGTGTTGAGG - Intergenic
936520435 2:113208900-113208922 TTTCTTTGCTCAAGGGAGTGTGG + Intronic
938100379 2:128493941-128493963 TTTCTATGCTGAAGACTGTCAGG - Intergenic
940113886 2:150186434-150186456 TTTCAATGCTGTAGGTATTGTGG + Intergenic
940765643 2:157786971-157786993 TTGCTCTGCTGAAGGTGATAAGG + Intronic
941441914 2:165548787-165548809 TTTCTATGATGAATCTGTTGTGG + Intronic
941701781 2:168611286-168611308 TTTCTATGCTGATAATGCTGGGG - Intronic
942809620 2:179982398-179982420 TTTTTATACTGGAGGTGATGGGG + Intronic
943454628 2:188089629-188089651 TTTCTATCCTGATTTTGGTGGGG + Intergenic
944073322 2:195697577-195697599 ATTCCATGGTGAAGGTGGGGAGG - Intronic
944612122 2:201421700-201421722 ATTCTTTGCTGGAGATGGTGTGG + Intronic
945006059 2:205407986-205408008 TTTCAATGCTGAAGCTGAAGAGG - Intronic
946338310 2:219053199-219053221 TGTCTGTGTTGAAAGTGGTGGGG - Intergenic
947689312 2:232120261-232120283 TTTGGATTCTGAAGGTAGTGTGG + Intronic
1170370626 20:15644252-15644274 TTTAGATGCTGGAGGTGGTGGGG - Intronic
1172250819 20:33477916-33477938 TTTCTCTGCTGGTGGTGTTGGGG - Intergenic
1173136712 20:40445183-40445205 TTGCTAAGCTGGAGGTGTTGCGG + Intergenic
1173790451 20:45824594-45824616 GTTTGATGCTGATGGTGGTGGGG - Exonic
1175029942 20:55942303-55942325 TTTCTATGCTGATTTTGCTGAGG + Intergenic
1179443615 21:41414921-41414943 TTTCTATGCTGATTTTGCTGAGG - Intergenic
1181373754 22:22439974-22439996 TTTTGATGCTGAAGGTGGGTGGG + Intergenic
1181524642 22:23473403-23473425 TTTCTGTATTGCAGGTGGTGCGG - Intergenic
1182686882 22:32128070-32128092 CTTCTGTGCTGAATGTGGTGGGG - Intergenic
1183096101 22:35553211-35553233 TGTGTGTGCAGAAGGTGGTGGGG - Exonic
1183631635 22:39036614-39036636 TGTGTGTGCTCAAGGTGGTGTGG + Intergenic
1184954748 22:47878483-47878505 TTTCTATGCCCAAGGTCATGTGG + Intergenic
950291959 3:11791913-11791935 TCTCAATGCTGAAGTGGGTGGGG - Intronic
950526980 3:13529960-13529982 ACTCCATCCTGAAGGTGGTGGGG + Intergenic
951655775 3:25006592-25006614 TTTCTATTTTTAAAGTGGTGAGG + Intergenic
952638823 3:35566771-35566793 TTTCCAAGCTGAAGGATGTGAGG - Intergenic
955053204 3:55432062-55432084 CATCTATGCTGAAGTTTGTGGGG - Intergenic
957034455 3:75281092-75281114 TCCCTCTGCTGAAGGAGGTGGGG - Intergenic
957254933 3:77824951-77824973 TTTCTCTTCTGTAGGGGGTGGGG + Intergenic
958881118 3:99671595-99671617 TTACTATGGGGTAGGTGGTGGGG - Intronic
961078366 3:124002994-124003016 TCCCTCTGCTGAAGGAGGTGGGG - Intergenic
961086370 3:124071072-124071094 TTTCTATGTGGAAGGTGATCAGG + Intergenic
961372737 3:126441295-126441317 TTTCTATGCTGAAGGTGGTGGGG - Intronic
962051099 3:131816542-131816564 TTTCAATCCTAAAAGTGGTGGGG - Intronic
962226256 3:133612544-133612566 TTTCTCTGCTTAAGGTGGATTGG - Exonic
962389842 3:134962300-134962322 TTTGTGTGCTGCAGGTGGTTCGG + Intronic
963023538 3:140896745-140896767 CTGCTCTGGTGAAGGTGGTGGGG + Intergenic
963622525 3:147629403-147629425 ATTCTTTCCTGGAGGTGGTGAGG - Intergenic
964743091 3:159988058-159988080 TTTCTGTGCTGAGAGTAGTGGGG - Intergenic
965238963 3:166168708-166168730 CTTTTATCCTGAAGGTGGTGTGG - Intergenic
966366199 3:179190312-179190334 CTTTTATGCTGGGGGTGGTGGGG - Intronic
967010279 3:185426540-185426562 ATTTTATACTGAAGGTGATGGGG - Intronic
967252428 3:187554555-187554577 TTTCTATGCTGAATGTATGGAGG - Intergenic
967806388 3:193717749-193717771 TTTTTATGCTGAAGATGATGGGG + Intergenic
968045142 3:195619766-195619788 TTTCTATGGTGCTGTTGGTGGGG - Intergenic
969718806 4:8881793-8881815 TTTCCATGGTGGTGGTGGTGGGG + Intergenic
971789434 4:31149410-31149432 TTTCTAAGCTGCAGGGAGTGAGG + Intergenic
973023184 4:45230283-45230305 TTCCTATGCTGAAGTTTGTTTGG - Intergenic
974354302 4:60792509-60792531 TTTCCATGATGAATGTGCTGCGG - Intergenic
974674401 4:65071866-65071888 TTTCTTTGTTGCAGGGGGTGAGG - Intergenic
975459922 4:74639370-74639392 GTTCTATGCTGAAAGTGATGAGG + Intergenic
977566916 4:98589851-98589873 TGTCTCTGTGGAAGGTGGTGGGG + Intronic
978369565 4:108016715-108016737 TTCCAAGGCTGGAGGTGGTGAGG - Intronic
979409030 4:120351516-120351538 ATTTTATCCTGAAGGTGATGGGG + Intergenic
980761104 4:137235216-137235238 TTTCTATGCTGATTTTGCTGAGG + Intergenic
983961731 4:173762476-173762498 CTTATATCCTGAAGGTGGGGGGG + Intergenic
986399012 5:7361348-7361370 TTTCTTTGATGAAGGTAGTCGGG - Intergenic
986951422 5:13090484-13090506 TTTTATTGCTGAAGGTGGGGTGG - Intergenic
987123724 5:14792037-14792059 TGCCTGTGCTGAAGATGGTGAGG + Intronic
987729619 5:21752123-21752145 TTACGATGATGAAGGAGGTGGGG - Exonic
991975997 5:72184089-72184111 TATTTATGCTGGGGGTGGTGGGG + Intronic
992065206 5:73100681-73100703 ATTCTAGTATGAAGGTGGTGTGG + Intergenic
992170151 5:74093356-74093378 TTTCTCTGCTGCAGCTGCTGGGG + Intergenic
992886135 5:81162181-81162203 TTTCTTTGTTGGGGGTGGTGGGG + Intronic
995867662 5:116708729-116708751 TTCCTTTGCTGAAGGTGGACAGG - Intergenic
997312241 5:132896749-132896771 TTTCTCTGCTGTAGGTCGAGGGG + Exonic
997702831 5:135916364-135916386 GTTATATGCTGAAGATGGTTGGG + Intergenic
998224758 5:140318379-140318401 TCTCTTTGCTGAAGGGGGTGGGG - Intergenic
999068676 5:148718849-148718871 TTTCTATTCTGAAGGAGGAAGGG - Intergenic
1000681868 5:164194987-164195009 TTTCTTTGCATAAGATGGTGGGG + Intergenic
1000899503 5:166895563-166895585 TTTCTACGGTGAACATGGTGGGG - Intergenic
1001185010 5:169562185-169562207 TTTCTATCCTGAGAGTGGGGTGG + Intergenic
1002599503 5:180346280-180346302 TTTCTATGCTGATTGTGGGGAGG - Intronic
1004180753 6:13378773-13378795 TTCCTAGGCTGCAGGAGGTGGGG - Intronic
1006114807 6:31769909-31769931 TCTAGGTGCTGAAGGTGGTGGGG + Intronic
1006120407 6:31801381-31801403 TTTCACTGCTGGAGATGGTGGGG - Intronic
1006865789 6:37208109-37208131 TTTCTACCCTGAGTGTGGTGGGG + Intergenic
1007997779 6:46326896-46326918 TTTCTATGCTAAAGGTAATCAGG + Intronic
1012466891 6:99525457-99525479 TTTCAAATCTGAAGGGGGTGAGG + Intergenic
1012741459 6:103020814-103020836 TTTCCATGGTGGAAGTGGTGGGG + Intergenic
1015328754 6:131952978-131953000 GCTCTATGCTGAAGTTGGAGTGG - Intergenic
1019122791 6:169817077-169817099 TTTCTATGCTGACTTTGCTGAGG + Intergenic
1019703731 7:2487717-2487739 TGTCTCTGCAGAAGCTGGTGTGG - Intergenic
1021101777 7:16592525-16592547 GTTCTGTGCTGCAGATGGTGTGG - Intergenic
1022379637 7:29847758-29847780 TTTTTACACTGAAGGCGGTGGGG + Intronic
1027718733 7:81710549-81710571 ATTTTATGTTGAGGGTGGTGAGG - Intronic
1027732938 7:81899014-81899036 TTTCTATGCTGATTTTGCTGAGG + Intergenic
1027789256 7:82618870-82618892 TGTTTATTCTGAAAGTGGTGTGG + Intergenic
1030735841 7:113047668-113047690 TATCTATGGTGATGATGGTGGGG - Intergenic
1033604731 7:142918553-142918575 TTTCTATTCTGAAGGCATTGGGG - Intronic
1035842987 8:2832471-2832493 TTTCAAGGCTGAAGATGGAGAGG + Intergenic
1037293068 8:17371660-17371682 TTTCTAAGCTGTTGGTGGTCGGG + Intronic
1038433437 8:27518377-27518399 TTTCAATGCTTTAGATGGTGAGG - Intronic
1038504181 8:28070412-28070434 TTTCTATGCTGATAGAGGTGAGG - Intronic
1039030420 8:33303135-33303157 TTTCTATGCTGATTTTGCTGAGG - Intergenic
1042026560 8:64430282-64430304 TTTCTTTGGTGAAGGTTTTGTGG - Intergenic
1043445809 8:80318253-80318275 TATCTATGTTCAAGTTGGTGAGG - Intergenic
1043647656 8:82541257-82541279 TGGCTCTTCTGAAGGTGGTGAGG + Intergenic
1044611657 8:94097990-94098012 TTGCTGTGCTGAAGGCAGTGTGG - Intergenic
1045566291 8:103319399-103319421 TTTTTATGCTGAAAGCAGTGAGG + Intronic
1046836191 8:118804360-118804382 TTTCTAACCTGAAAGAGGTGTGG - Intergenic
1047370688 8:124253446-124253468 TTTCAAGGCTGAAGGGGCTGTGG - Intergenic
1049183105 8:141233507-141233529 TATTTTTGCTGCAGGTGGTGGGG - Intronic
1050436442 9:5615367-5615389 TTTCTTTTTTGAAGGGGGTGAGG - Intergenic
1050615651 9:7399156-7399178 TTTAGATTCTGTAGGTGGTGGGG + Intergenic
1051916294 9:22211900-22211922 TTTGTATCCTGAAGGGGGAGAGG + Intergenic
1052069676 9:24067045-24067067 ATTCTATGCTGATGTTGGTAAGG + Intergenic
1053122844 9:35559349-35559371 TTTCATTGCTGGAGGTGGGGAGG + Intronic
1053291901 9:36885785-36885807 TTTTCAAGCTGATGGTGGTGAGG - Intronic
1055542834 9:77331138-77331160 TTTTTATAATGAAAGTGGTGTGG + Intronic
1055780316 9:79814040-79814062 TCTCTATGATGAAGGAGGTAGGG + Intergenic
1056768693 9:89461190-89461212 TTACAAGGCTTAAGGTGGTGTGG + Intronic
1057488244 9:95503221-95503243 TTTCTTTGCTGATAGTGATGAGG + Intronic
1057824525 9:98361727-98361749 CTTCTATGTGGAAGGTGGTCAGG + Intronic
1057907871 9:98996235-98996257 TTTCTAAGCTAAAGGGGCTGGGG - Intronic
1058525452 9:105852943-105852965 TTTCTATGCTAAAGGATATGGGG + Intergenic
1058900162 9:109435211-109435233 TTCCTATGCTGCAGGGGTTGAGG - Intronic
1059032994 9:110721057-110721079 TTTCTATGCTGATTTTGCTGAGG - Intronic
1061075095 9:128336375-128336397 TTTCTAGGCAGAAGTTGGTAGGG - Intergenic
1061805593 9:133135973-133135995 TTTCTCTACTGAAGGAGATGAGG + Intronic
1186223201 X:7371435-7371457 ATTCTAGGCAGAAGGTGGTAGGG + Intergenic
1186733719 X:12438828-12438850 TTTCTAAACTGAAGGTGAAGAGG + Intronic
1188366850 X:29326426-29326448 TTCCTATGCTGAAAGTGGAGTGG - Intronic
1190230295 X:48576494-48576516 TTTTTCTGCTCTAGGTGGTGGGG + Exonic
1190296396 X:49030169-49030191 CTTCCATGCTGAAGCTGCTGCGG + Exonic
1190952404 X:55159687-55159709 CTTGTATGCTGAATGTGGTTAGG + Intronic
1192566638 X:72169816-72169838 TTCCTATGCTGTAGGTGAAGTGG + Intergenic
1193314566 X:80048937-80048959 CTTCTATGCTGATTTTGGTGAGG + Intergenic
1193636703 X:83959308-83959330 TTTCTATGCTGATTTTGCTGGGG - Intergenic
1196111080 X:111947862-111947884 GTTCAATGCTGATGGTGGAGGGG + Intronic
1197147283 X:123184625-123184647 TACCTATGCTGATGGTGTTGGGG - Exonic
1199208146 X:145173748-145173770 CTTCTATGAAGAAGGTGGAGAGG - Intergenic
1199750869 X:150816284-150816306 TTTGGAGGCTGAGGGTGGTGAGG + Intronic