ID: 961372738

View in Genome Browser
Species Human (GRCh38)
Location 3:126441296-126441318
Sequence CTTTCTATGCTGAAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372738_961372746 16 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372738_961372747 17 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372738_961372748 20 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372738_961372745 15 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372738_961372743 0 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372738_961372752 29 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372738 Original CRISPR CTTTCTATGCTGAAGGTGGT GGG (reversed) Intronic
901892222 1:12276511-12276533 ATTTCTGTGCTCAAGGTGTTTGG + Exonic
905272227 1:36794592-36794614 CTTTCCATGTGGCAGGTGGTAGG - Intergenic
907661047 1:56392711-56392733 CTTTTTATTCTGAAGGAAGTGGG - Intergenic
908319897 1:62968970-62968992 ATTTCTGTGCTGAATGTGCTGGG - Intergenic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
910553891 1:88507981-88508003 TGTTCTATGCTGATTGTGGTGGG - Intergenic
911534388 1:99082668-99082690 CTATCTATACTTAAAGTGGTAGG + Intergenic
911870941 1:103097645-103097667 CATTATATGCTAAAGGTAGTTGG - Intronic
914333166 1:146691183-146691205 CTTTCTGAGCTGAAGTTGGGTGG - Intergenic
916621933 1:166508136-166508158 CTTTCTATGATGATGGCAGTGGG + Intergenic
917509110 1:175655680-175655702 GTTTCTTTGCTAATGGTGGTGGG - Intronic
921664050 1:217845367-217845389 CTTTCTAGGCTCCAGGTGGAAGG + Intronic
922352993 1:224750114-224750136 CTTTGTATGTGGTAGGTGGTAGG + Intergenic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG + Intergenic
1065962888 10:30748592-30748614 CTTTCTGTATTGAAGGGGGTGGG - Intergenic
1067203934 10:44197882-44197904 CTTTCTAGGCAGGAAGTGGTAGG + Intergenic
1069976151 10:72215023-72215045 CTATCTAAGCTGTACGTGGTAGG - Intronic
1070464974 10:76712084-76712106 CTTGCTCTGGTGGAGGTGGTGGG - Intergenic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1073758049 10:106602219-106602241 ATATTTATTCTGAAGGTGGTAGG + Intronic
1074214381 10:111370029-111370051 CTCTCTATGCTGGACATGGTTGG - Intergenic
1074692855 10:116022355-116022377 CTTTGTATCCTAAAGGTGGCAGG - Intergenic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1076480717 10:130783667-130783689 CTTTTCATGCTAAAGGGGGTGGG - Intergenic
1077095009 11:795550-795572 CTCTCTGTGCTGAAGGATGTGGG - Intronic
1078615496 11:12861648-12861670 GTTTGTATGCTGTGGGTGGTGGG - Intronic
1080346283 11:31329357-31329379 CTTTCTTTGCTTAAGCTAGTTGG + Intronic
1086385281 11:86301120-86301142 CTTTTTATTCTGAAGGTTCTAGG + Intergenic
1089079505 11:115764056-115764078 TTTTCTTTCCTGAAGGAGGTTGG - Intergenic
1089213823 11:116823536-116823558 CCTTCCATGCTGAGGTTGGTGGG - Intergenic
1089438358 11:118492151-118492173 CTTTATACTCTGAAGGTGATAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090941838 11:131393870-131393892 CTTAATAGGCTGAAGGAGGTAGG - Intronic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1099281857 12:80660005-80660027 CTTTCTAAGGTGAAGATTGTAGG - Intronic
1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG + Intergenic
1101555516 12:105805214-105805236 ATTTCTATGCAGAAGGTGATAGG - Intergenic
1107307108 13:39034427-39034449 CTTTCTTTGTAGAAGTTGGTAGG - Intronic
1107483595 13:40805433-40805455 CTTTTTATGCAGTGGGTGGTGGG - Intronic
1109095276 13:58106499-58106521 ATGCCTATGCTGAAGGTTGTTGG - Intergenic
1110548080 13:76779226-76779248 GATTCTATGATGAAGGTGGAAGG - Intergenic
1110664751 13:78103805-78103827 CTTTCTAACCTGGTGGTGGTAGG - Intergenic
1110675042 13:78232406-78232428 TATTCTATGGTGAAGGTTGTAGG - Intergenic
1111166688 13:84466732-84466754 TTTTCTATGTTGAAGGTATTTGG - Intergenic
1111928812 13:94492335-94492357 TCTTCTAAGTTGAAGGTGGTTGG + Intergenic
1114271344 14:21102171-21102193 CTTCCTAGGCTGAGGGTTGTAGG - Intronic
1114317957 14:21524849-21524871 CTTTCTCTGCTGGAGGGGTTGGG - Exonic
1118310966 14:64692755-64692777 CTTTCTAGGCTGGAGGCTGTGGG + Intergenic
1120020423 14:79524113-79524135 CTTTGTTTGCTGAAGGTCGCAGG - Intronic
1121573259 14:94963291-94963313 CATCCTATGCTGAAAGTGTTTGG + Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1126850425 15:52793564-52793586 TTTTCTTTGCTGAACCTGGTAGG - Intergenic
1127134861 15:55909626-55909648 CTTTGTAGGCTGAAGGGGCTTGG - Intronic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1128660486 15:69497445-69497467 CTTTCTATTCTGAGTTTGGTTGG - Intergenic
1129384420 15:75188129-75188151 CACTCTATGCTGAAGGGGCTGGG - Intergenic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1132502471 16:290611-290633 CTTTATGTGCTCAAGGTGGCAGG - Intronic
1135875476 16:26196129-26196151 CTTTTAATGCTGGAGGTGGGGGG - Intergenic
1138011679 16:53386587-53386609 CCTCCTTAGCTGAAGGTGGTGGG + Intergenic
1140000455 16:71020071-71020093 CTTTCTGAGCTGAAGTTGGGTGG + Intronic
1140906964 16:79417403-79417425 CATTCTATTTTGAAGGTGGAGGG + Intergenic
1141839545 16:86566005-86566027 GTTTCGAAGCTGAAGTTGGTAGG + Intergenic
1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG + Exonic
1147253376 17:39166603-39166625 CTTTCTTTGCTTAAGCTGGGGGG + Intronic
1151322529 17:73360416-73360438 CATTCTTGGCTGAAGGGGGTGGG + Intronic
1154026196 18:10709506-10709528 ATTTCCAGGCTGAACGTGGTAGG + Intronic
1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG + Intergenic
1155741697 18:29297431-29297453 CTTTCATTGCTGAAGGTTATGGG + Intergenic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG + Intergenic
926438730 2:12864186-12864208 CTTTCTATGCAGCAAGTGGGAGG + Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
926887275 2:17609796-17609818 CTTCATATGCTGTAGGTGATGGG + Intronic
928044362 2:27913020-27913042 CTTTAGATGCTGAAGGTCCTTGG - Intronic
929700398 2:44157610-44157632 CTTTTTATGCTAAACATGGTAGG - Intergenic
930772013 2:55138357-55138379 CTCTCTATTCTGAAAGTCGTAGG + Intergenic
933616175 2:84484492-84484514 CTTTCTCTACTGGAGGTTGTGGG + Intergenic
936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG + Intergenic
937561551 2:123230924-123230946 CCTGCTTTGGTGAAGGTGGTAGG + Intergenic
938943620 2:136191039-136191061 CTTGCTAAGCTGAAGGCTGTTGG + Intergenic
941303819 2:163835706-163835728 CCTTCTTCCCTGAAGGTGGTCGG - Intergenic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
942975974 2:182018219-182018241 GTTTCTATGCTGGATGTGTTAGG + Intronic
943471750 2:188303240-188303262 CTTTTTGCCCTGAAGGTGGTAGG + Intronic
947610169 2:231520203-231520225 CTTTTTCTGCTGAAGTTGGCTGG - Intergenic
948492965 2:238325458-238325480 ATTTCTCTGCTGCATGTGGTTGG + Intronic
1170370627 20:15644253-15644275 GTTTAGATGCTGGAGGTGGTGGG - Intronic
1170654606 20:18274456-18274478 CTCTCCCTGCTGAAGATGGTTGG + Intergenic
1174910304 20:54600872-54600894 TTCTCTATGCTGGAGGTGTTAGG + Intronic
1177282197 21:18995061-18995083 CTTTCTATGCAGCAAGTGGCAGG - Intergenic
1181364310 22:22363370-22363392 CTTTTGATGCTGAAGGTGCGTGG + Intergenic
1181373753 22:22439973-22439995 CTTTTGATGCTGAAGGTGGGTGG + Intergenic
1182315912 22:29447139-29447161 CTTTCTGGGGTGAAGGTGGGTGG - Intergenic
1182670315 22:31990335-31990357 CTTTCTATTCTCTAGGGGGTAGG + Intergenic
1182686883 22:32128071-32128093 CCTTCTGTGCTGAATGTGGTGGG - Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949761055 3:7471433-7471455 GTTTCTCTGCTGACAGTGGTGGG + Intronic
952683983 3:36129265-36129287 CTTGCCAAGCTGCAGGTGGTGGG + Intergenic
954390730 3:50266873-50266895 CTTTCTAGGTTGGAGGTGGGAGG - Intergenic
955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG + Intronic
956890882 3:73613191-73613213 ATTTTTATTCTGAAGGTGGTGGG + Intronic
957509867 3:81173696-81173718 TTTTCTATACTGAATGTAGTTGG - Intergenic
958029979 3:88096975-88096997 CTTTCTATGCTGATGGGGAAAGG - Intronic
961078367 3:124002995-124003017 CTCCCTCTGCTGAAGGAGGTGGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963023537 3:140896744-140896766 CCTGCTCTGGTGAAGGTGGTGGG + Intergenic
963318851 3:143790344-143790366 CTTTTCTTACTGAAGGTGGTTGG - Intronic
964743092 3:159988059-159988081 CTTTCTGTGCTGAGAGTAGTGGG - Intergenic
964973681 3:162592396-162592418 CTTTTTATGCTGAAAATTGTAGG + Intergenic
965602562 3:170469484-170469506 CTTTCTTTTCTGTAGGTGGGGGG + Intronic
966221353 3:177554421-177554443 CTTTCAGTGCTGAAGGTACTTGG + Intergenic
966275809 3:178166897-178166919 CTTTTTATCCTGAAGGGTGTTGG - Intergenic
967806387 3:193717748-193717770 ATTTTTATGCTGAAGATGATGGG + Intergenic
968045143 3:195619767-195619789 CTTTCTATGGTGCTGTTGGTGGG - Intergenic
974785024 4:66609108-66609130 CTTTCTCTGATGGAGGTGGCTGG + Intergenic
975554383 4:75646140-75646162 CTTGCTTTGCTGAAGAAGGTGGG - Intronic
978126567 4:105143406-105143428 TTTTCTATTCTGCAGGTGGGAGG + Intergenic
979136661 4:117118694-117118716 TTTGCTGTGCTGCAGGTGGTGGG - Intergenic
984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG + Exonic
986399013 5:7361349-7361371 GTTTCTTTGATGAAGGTAGTCGG - Intergenic
987411962 5:17623903-17623925 TATTCTATCCTGAAGGTGCTGGG - Intergenic
989714443 5:44444664-44444686 GTTACTATGCTGAATATGGTAGG - Intergenic
990685833 5:58300084-58300106 CCTTCTATGTGGAAGGGGGTTGG - Intergenic
991435268 5:66591822-66591844 CTTTGTCTCCTCAAGGTGGTTGG + Intergenic
992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG + Intergenic
992857679 5:80879730-80879752 GTTTCTAAGCTGAAGGAGTTTGG - Intergenic
994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG + Intergenic
996007422 5:118439542-118439564 CTTTATATGTTGAGGGTGGGTGG - Intergenic
996655737 5:125933743-125933765 CTTTCTATGCAGCAAGTGGCAGG + Intergenic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
998224759 5:140318380-140318402 CTCTCTTTGCTGAAGGGGGTGGG - Intergenic
999068677 5:148718850-148718872 GTTTCTATTCTGAAGGAGGAAGG - Intergenic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1004319325 6:14620506-14620528 CTTTCTATGCTGCAGTTTCTTGG + Intergenic
1009646432 6:66408796-66408818 CTTTCTATGCTTTATGTGATTGG - Intergenic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1012483179 6:99690341-99690363 CTTTGTTTGCTCAAGGTTGTAGG - Intergenic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1015244382 6:131061668-131061690 GTTTCTATGCTGCAGGGGCTAGG - Intronic
1023574745 7:41615194-41615216 CATACTCTGCTGAAGGAGGTAGG - Intergenic
1027984060 7:85262853-85262875 CTCTCTATGCATAAGGGGGTAGG + Intergenic
1028413420 7:90555326-90555348 CTTTCTACGCTGATGATAGTTGG - Intronic
1029236978 7:99128675-99128697 CTTTCTAAACTGAATGTGCTGGG + Intronic
1030735842 7:113047669-113047691 CTATCTATGGTGATGATGGTGGG - Intergenic
1037293067 8:17371659-17371681 TTTTCTAAGCTGTTGGTGGTCGG + Intronic
1037959915 8:23089200-23089222 CTTTCTACCCTGAAGTAGGTAGG - Intronic
1046850855 8:118971307-118971329 GTTTCTATGCTGAAAGTCATAGG + Intergenic
1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG + Intergenic
1049183106 8:141233508-141233530 CTATTTTTGCTGCAGGTGGTGGG - Intronic
1049376358 8:142291202-142291224 CTTTCTGAGATGAGGGTGGTGGG - Intronic
1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG + Intergenic
1051062392 9:13059360-13059382 GTTTCTATGTTGAAGGAGGCTGG - Intergenic
1051095538 9:13461500-13461522 TTTTTTATGCTGAAAGTGTTAGG + Intergenic
1052231254 9:26156509-26156531 CTTTCTATGTATAAGGTGCTAGG - Intergenic
1053314754 9:37041871-37041893 CATTCCAGGCTGAGGGTGGTTGG - Intergenic
1055395096 9:75865722-75865744 TTTTCCAGGCTGAGGGTGGTTGG - Intergenic
1055780315 9:79814039-79814061 GTCTCTATGATGAAGGAGGTAGG + Intergenic
1057907872 9:98996236-98996258 CTTTCTAAGCTAAAGGGGCTGGG - Intronic
1061075096 9:128336376-128336398 GTTTCTAGGCAGAAGTTGGTAGG - Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1186344261 X:8675333-8675355 CTTTCTCTGCTGAGCGTGGCAGG - Intronic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1189173699 X:38933414-38933436 CTTACTCTGGTGGAGGTGGTTGG + Intergenic
1192002699 X:67172261-67172283 CTTTTTTTGTTGATGGTGGTAGG + Intergenic
1193636704 X:83959309-83959331 CTTTCTATGCTGATTTTGCTGGG - Intergenic
1195179095 X:102339557-102339579 GTTTCTAGGCAGAAGGGGGTGGG - Intergenic
1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG + Intergenic
1197921544 X:131599547-131599569 CTTTTTATGCTTAAGGAAGTAGG + Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic
1200705492 Y:6439035-6439057 CTGACTATGCTGTAGGTTGTGGG - Intergenic
1200705821 Y:6441605-6441627 CTGCCTATGCTCAAGGAGGTGGG - Intergenic
1201028290 Y:9723103-9723125 CTGCCTATGCTCAAGGAGGTGGG + Intergenic
1201028619 Y:9725673-9725695 CTGACTATGCTGTAGGTTGTGGG + Intergenic