ID: 961372739

View in Genome Browser
Species Human (GRCh38)
Location 3:126441297-126441319
Sequence CCTTTCTATGCTGAAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372739_961372748 19 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372739_961372747 16 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372739_961372752 28 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353
961372739_961372746 15 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372739_961372743 -1 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372739_961372745 14 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372739 Original CRISPR CCTTTCTATGCTGAAGGTGG TGG (reversed) Intronic
903230501 1:21919516-21919538 CCTTTCTTTGGTCCAGGTGGGGG - Intronic
904353567 1:29924374-29924396 CTTATCTATGATGGAGGTGGAGG + Intergenic
906896172 1:49774475-49774497 CCTTTATATGGGGCAGGTGGAGG + Intronic
910359829 1:86404530-86404552 CATTTCTAGGCTGAGGGTGGAGG + Intergenic
917948032 1:179997154-179997176 CCTTTATATGCTGGAGCAGGTGG - Exonic
918024671 1:180731903-180731925 CCTTTCTAGGCTGGGCGTGGTGG + Intronic
920882923 1:209897279-209897301 CCATGCTGTGCTGAAGCTGGTGG + Intergenic
921334987 1:214076827-214076849 CCTTTCTGTGGTGGTGGTGGAGG - Intergenic
921381303 1:214527164-214527186 CTTTCCTCTGCAGAAGGTGGGGG - Intronic
1063146500 10:3299425-3299447 CCTAGCTAGGCTGGAGGTGGAGG + Intergenic
1065787019 10:29225599-29225621 CCTTCCTATGTTGAAGTTGGGGG + Intergenic
1066129428 10:32378015-32378037 CCTTGGTATAATGAAGGTGGAGG - Intronic
1067296952 10:44980055-44980077 CCTGCCTGTGCTGCAGGTGGGGG + Intronic
1069108677 10:64415656-64415678 CCCAGCAATGCTGAAGGTGGTGG + Intergenic
1069748629 10:70731898-70731920 ACTTTCTATGCAGGAGTTGGGGG - Intronic
1075077623 10:119361510-119361532 CAATTCTATGTTGAAGGTGAGGG + Intronic
1075485313 10:122817712-122817734 GCTCTCTATCCTGATGGTGGTGG - Intergenic
1076810763 10:132885368-132885390 TCTTTTTAAGCTGGAGGTGGAGG - Intronic
1077162337 11:1119506-1119528 CCTTTTGAGGCTGAAGGGGGCGG + Intergenic
1077377725 11:2213096-2213118 CCTCTCCAGGCTGCAGGTGGGGG - Intergenic
1079654821 11:22974469-22974491 CCTTCCTTGGTTGAAGGTGGGGG + Intergenic
1080953633 11:37066562-37066584 CCTTGGTATGCTGAAGGGGAAGG + Intergenic
1083148685 11:60776486-60776508 CCTGTCGATGCTGACTGTGGTGG - Exonic
1084468514 11:69341494-69341516 CCTTCCTACCTTGAAGGTGGAGG + Intronic
1086856385 11:91871291-91871313 CCTTTCTAAGCCTAAGGTAGTGG - Intergenic
1087982004 11:104626864-104626886 CTTTTCTATGCTGCTGGTGATGG - Intergenic
1088089563 11:106022167-106022189 CGGTTCTATGCTGGAGGAGGCGG - Exonic
1088756309 11:112888211-112888233 CTTTTCTTTGCTCAATGTGGTGG - Intergenic
1089213825 11:116823537-116823559 CCCTTCCATGCTGAGGTTGGTGG - Intergenic
1089807251 11:121102140-121102162 CCATTCTATGGAGAAGGTGATGG + Intronic
1092172592 12:6383380-6383402 CCTCTCCATGCTTAAGGTGAGGG + Intronic
1094472243 12:30814129-30814151 CAGTTCTATGTTGATGGTGGTGG - Intergenic
1096648761 12:53051842-53051864 CTTTCCTAGGCTGAAGGTGGAGG - Exonic
1097278983 12:57832876-57832898 TATTTCTATGCTGAAATTGGAGG + Intronic
1101696461 12:107132003-107132025 GCTTTCTATCCTGAATGTGTTGG - Intergenic
1102025477 12:109712201-109712223 CCTCCCCAGGCTGAAGGTGGGGG - Intergenic
1102424393 12:112829557-112829579 CCTTTGTAGGCTGGGGGTGGTGG - Intronic
1103983343 12:124750921-124750943 CCTTTCTGGGGTGAAGGGGGCGG + Intergenic
1105830810 13:24161531-24161553 CCATTCTGTGCAGGAGGTGGGGG + Intronic
1111465475 13:88603031-88603053 CCTATCATTGCTGGAGGTGGGGG - Intergenic
1111754005 13:92369462-92369484 CAGCTCTAGGCTGAAGGTGGTGG - Intronic
1114317958 14:21524850-21524872 CCTTTCTCTGCTGGAGGGGTTGG - Exonic
1114933611 14:27506575-27506597 TCTTTGTGTGCTGCAGGTGGGGG + Intergenic
1115317858 14:32045232-32045254 CCTTTCTATTCTGAATTTTGGGG - Intergenic
1118310965 14:64692754-64692776 CCTTTCTAGGCTGGAGGCTGTGG + Intergenic
1121316244 14:92962594-92962616 CGTTTCTATGGTGTGGGTGGAGG + Intronic
1123162143 14:106288938-106288960 CCTTTCTCAGCTGCAGGAGGCGG - Intergenic
1123180265 14:106463104-106463126 CCTTTCTCAGCTGCAGGAGGCGG - Intergenic
1125513440 15:40305118-40305140 CCTCACTAGGCTTAAGGTGGGGG - Intronic
1125614191 15:40995141-40995163 CATTTCTAGGCTGAACGCGGTGG - Intronic
1126956137 15:53935726-53935748 CCTATCTTGGCTGAGGGTGGGGG - Intergenic
1127869901 15:63063106-63063128 ACTTTATATCCTGAAGGAGGAGG + Intronic
1129671069 15:77607902-77607924 CCTTTCTTTGTGGAAGTTGGGGG - Intergenic
1129951311 15:79594049-79594071 CCTTTCTATGCTGCCTCTGGGGG - Intergenic
1130273187 15:82462985-82463007 CCCGGCCATGCTGAAGGTGGTGG + Intergenic
1130465539 15:84190356-84190378 CCCGGCCATGCTGAAGGTGGTGG + Intergenic
1130487153 15:84404464-84404486 CCCGGCCATGCTGAAGGTGGTGG - Intergenic
1130498726 15:84483180-84483202 CCCGGCCATGCTGAAGGTGGTGG - Intergenic
1130587828 15:85194951-85194973 CCCGGCCATGCTGAAGGTGGTGG + Intergenic
1130821714 15:87503020-87503042 CCTTTTAAGGATGAAGGTGGAGG - Intergenic
1131641946 15:94302351-94302373 ACTTTCTTTGCTGATGCTGGTGG - Intronic
1132690967 16:1181736-1181758 CCTTTCATTCCTGGAGGTGGGGG + Intronic
1132983006 16:2748877-2748899 CCTTTCTTTTCTGGAGGGGGAGG - Intergenic
1133657337 16:7878561-7878583 CCTTTCTAGACTGTAGGTGGGGG - Intergenic
1134763965 16:16739528-16739550 CCTTTCTGTGGAGGAGGTGGAGG + Intergenic
1135508331 16:23058900-23058922 TCTTTCTATCCAGAAGATGGAGG - Intergenic
1135704735 16:24665360-24665382 TCTTTCCAGGCTGAATGTGGTGG - Intergenic
1135875477 16:26196130-26196152 CCTTTTAATGCTGGAGGTGGGGG - Intergenic
1136241800 16:28949219-28949241 CCTTTGAACCCTGAAGGTGGAGG + Intergenic
1137885460 16:52098284-52098306 CCTTTCTTTGTTGCAGGTGGAGG + Intergenic
1138011677 16:53386586-53386608 CCCTCCTTAGCTGAAGGTGGTGG + Intergenic
1139595381 16:67954767-67954789 CATTTCTCTGCTGTAGCTGGGGG - Exonic
1140193593 16:72838449-72838471 CCTGTCAATGCTCAAGTTGGAGG - Intronic
1140616238 16:76667940-76667962 CCTGCCTATGCTGAAGGAGTGGG - Intergenic
1140906963 16:79417402-79417424 CCATTCTATTTTGAAGGTGGAGG + Intergenic
1142387317 16:89774067-89774089 CCTTTTTATATTGAAAGTGGTGG - Intronic
1145049097 17:19645975-19645997 CATTTCTATAGTGAAAGTGGAGG - Intergenic
1145812548 17:27773237-27773259 CCTTTCTTTTCTGAAGGTAGAGG - Exonic
1147232804 17:39031371-39031393 CCTTGATATGCTGGAGGTTGGGG - Intergenic
1147253375 17:39166602-39166624 TCTTTCTTTGCTTAAGCTGGGGG + Intronic
1151322528 17:73360415-73360437 CCATTCTTGGCTGAAGGGGGTGG + Intronic
1155674280 18:28410621-28410643 CCTTTCTAGAATAAAGGTGGAGG - Intergenic
1156369512 18:36460219-36460241 CCTTTCTATGCTGCACTTGTTGG + Intronic
1161094837 19:2384289-2384311 CCTTTCTCTGCAGAGGGTGGGGG - Intergenic
1162328408 19:10012028-10012050 CCTCTTCATGCTGGAGGTGGGGG - Intergenic
1163093383 19:15036832-15036854 CTTTTTCATGATGAAGGTGGAGG - Intergenic
1166141514 19:40807802-40807824 CCTTTCTGTCCTGATGCTGGGGG - Exonic
1166713044 19:44949222-44949244 TCTTTCTGTGCTGAAGGGAGAGG + Exonic
1168202013 19:54822335-54822357 CCTTTATATGCTGGGTGTGGTGG + Intronic
1168206827 19:54856391-54856413 CCTTTATATGCTGGGTGTGGTGG + Intronic
925182734 2:1827452-1827474 CCCTTCTAGGCAGAGGGTGGCGG - Intronic
927099972 2:19780594-19780616 CCTTTCTGTGCTCACGGAGGTGG - Intergenic
928120329 2:28579312-28579334 CCTTGCTATGCTGGAGATGGAGG + Intronic
929140454 2:38662296-38662318 CATTTCTATGTTGAATGAGGAGG + Intergenic
929799712 2:45089177-45089199 CCTTTGTATACAGAAGGTGCAGG - Intergenic
931718136 2:65045756-65045778 CCTTTCTCTGCGGGGGGTGGGGG - Intergenic
931864961 2:66399596-66399618 CCTTTCTATGGTCACAGTGGTGG - Intergenic
936490789 2:112970429-112970451 CCTCTCTAGGCTGGAGGTGATGG + Intergenic
937205247 2:120232254-120232276 CCTGTCTCTGATGAAAGTGGGGG - Intergenic
940658102 2:156513317-156513339 CCTATTTATGCTGTAGGTGGTGG + Exonic
940976908 2:159956545-159956567 CATTTCTGTGCTGAAGAAGGGGG - Exonic
943868892 2:192966416-192966438 TCTTTCTATGGTGAAGGAGCAGG + Intergenic
944274405 2:197819189-197819211 CCTTTCTAGTCTTAAGCTGGAGG - Intronic
945314910 2:208360673-208360695 GCCTTCTGTGGTGAAGGTGGGGG + Intronic
948152610 2:235756209-235756231 GCTTTCTCTGCTGCGGGTGGCGG + Intronic
948337167 2:237218443-237218465 CCTTTCATTCCTGAGGGTGGGGG - Intergenic
949001603 2:241617728-241617750 CCTTCCTCTGCTGTAGCTGGTGG - Intronic
1170144984 20:13163491-13163513 GCAATCTTTGCTGAAGGTGGGGG - Intronic
1170629197 20:18053913-18053935 CCTTTCTATGCTCCAGCTGCGGG + Intronic
1170880777 20:20295228-20295250 TCCTTGTAAGCTGAAGGTGGGGG + Intronic
1172133767 20:32673594-32673616 CCTGTCTGTGCTGAAAGTGTGGG - Intergenic
1172282089 20:33715115-33715137 CCTTTTTATGCTGAGCGTGATGG - Intronic
1179576870 21:42313394-42313416 CCTTTCTGGGCTGGAGATGGAGG - Intronic
1182236761 22:28882951-28882973 CCGTTCGATCCTGGAGGTGGGGG + Intergenic
1182242841 22:28930868-28930890 TCCTGCCATGCTGAAGGTGGAGG + Intronic
1182686885 22:32128072-32128094 GCCTTCTGTGCTGAATGTGGTGG - Intergenic
1183281139 22:36933367-36933389 CATTTCTAGACTGAAGGTGTGGG - Intronic
1183580657 22:38724390-38724412 CCTTTCAGAGCTGAAGTTGGAGG - Exonic
1183834944 22:40444666-40444688 CCCTTCTCTGATGAATGTGGTGG - Intronic
949191253 3:1251715-1251737 CCTTTCTAGACTGAAGATGCCGG - Intronic
949444473 3:4119148-4119170 TCTTTCTAATCTGAAGGTTGAGG - Intronic
950869126 3:16213624-16213646 GCTTGCTGTGCTGAAAGTGGGGG + Intronic
953860159 3:46537385-46537407 CCTTTTTAGGCTGGAGGCGGTGG - Intronic
955339275 3:58112363-58112385 CCTTTCTATGCAGTCGGTGCTGG + Intronic
955901537 3:63760761-63760783 CCTTACTAGGTTGAAAGTGGCGG - Intergenic
956890881 3:73613190-73613212 AATTTTTATTCTGAAGGTGGTGG + Intronic
958949531 3:100401310-100401332 CCCTTCTTTCCTGAAGGTAGAGG - Exonic
961372739 3:126441297-126441319 CCTTTCTATGCTGAAGGTGGTGG - Intronic
961412948 3:126736209-126736231 CCTTTCCATGCGGAAGATGCAGG - Intronic
962817213 3:139012251-139012273 CTGTCCTATGCTGAAAGTGGGGG + Intronic
964336458 3:155659875-155659897 CTTTTGGAGGCTGAAGGTGGTGG - Intronic
965602561 3:170469483-170469505 TCTTTCTTTTCTGTAGGTGGGGG + Intronic
968712134 4:2126898-2126920 TCTGTCTTTGCTGAAGGCGGGGG - Intronic
969496818 4:7530974-7530996 CCATCCTGTGCTGCAGGTGGTGG + Intronic
970724775 4:19030864-19030886 CCTTTCTGTGCTGCAGATGCTGG + Intergenic
973537063 4:51894071-51894093 ACTTTGTATGATGCAGGTGGTGG + Intronic
976013458 4:80520479-80520501 CATTTCCATGTTGAAGGTGAGGG - Intronic
976614205 4:87059625-87059647 GCTTTCTGTCCTGAAGGTGATGG - Intronic
977294631 4:95197426-95197448 ATTTGCTATGCTGAAGATGGAGG + Intronic
981045604 4:140262307-140262329 CCTTTGTTTGCTGAAGATTGAGG + Intronic
983961729 4:173762474-173762496 CACTTATATCCTGAAGGTGGGGG + Intergenic
985615394 5:917009-917031 CCCCTCTATGGTGACGGTGGGGG - Exonic
985832323 5:2242799-2242821 CCTCTCTCTGCTGAAGGAGTGGG + Intergenic
989240866 5:39201991-39202013 CCCTTCTAAGCTGACAGTGGGGG - Exonic
990207960 5:53450617-53450639 CACTGCTATGCTGGAGGTGGAGG - Intergenic
990649204 5:57879007-57879029 TCTTTCTTAGCTGGAGGTGGTGG - Intergenic
990911039 5:60852541-60852563 GCCTTATATGCTGAATGTGGTGG + Intergenic
994161959 5:96566818-96566840 CATTTCTATGCTCAAAGTTGTGG - Intronic
994587911 5:101734371-101734393 CCTTTCTAGGAAGAAGCTGGTGG + Intergenic
995264278 5:110139464-110139486 CCTTTGTTGGCTGGAGGTGGGGG + Intergenic
998224760 5:140318381-140318403 ACTCTCTTTGCTGAAGGGGGTGG - Intergenic
1004860895 6:19803995-19804017 CCTTTAAATCTTGAAGGTGGAGG - Intergenic
1005070370 6:21856809-21856831 CCTTTGTGAGCTGAAGATGGAGG + Intergenic
1011631136 6:89325889-89325911 CCTAGCTATGCAGGAGGTGGAGG - Intergenic
1015104155 6:129516909-129516931 GCTTTTTATGCTGAAGGTAGAGG + Intergenic
1015627605 6:135197047-135197069 CCTCTCTTTGCTGAAGCTGTAGG - Exonic
1016920536 6:149288971-149288993 CCTAGCTATTCTGGAGGTGGAGG - Intronic
1017263652 6:152416901-152416923 CCTTTCCCTGCAGGAGGTGGAGG + Exonic
1018102925 6:160457236-160457258 CTGTTCCATGCTGAAGGTGGAGG - Intergenic
1019420754 7:949669-949691 CCAGTCTAGGCTGAAGTTGGGGG + Intronic
1019729381 7:2622102-2622124 CCTTCCCATCCTGGAGGTGGGGG - Intergenic
1021112666 7:16713412-16713434 CCTTTTTAGGCCAAAGGTGGTGG + Intergenic
1022977934 7:35575726-35575748 CCTTTCTAGGCTGCAGTGGGAGG - Intergenic
1023077577 7:36499234-36499256 AAGTTATATGCTGAAGGTGGCGG + Intergenic
1023266488 7:38411503-38411525 CCTTTCTATCGTGCAGGTGAGGG + Intronic
1023430434 7:40085490-40085512 CCTTTCTATCCTGAAGCTCAGGG - Intronic
1024465735 7:49709932-49709954 CCTTTCCATCCTGAACCTGGAGG + Intergenic
1027595383 7:80167340-80167362 CTTTTCTGTGCTTAAGATGGTGG + Intronic
1028673943 7:93436441-93436463 CCTTTCTATGGCGGGGGTGGTGG + Intronic
1030735843 7:113047670-113047692 CCTATCTATGGTGATGATGGTGG - Intergenic
1030932639 7:115544077-115544099 CCATTCTTTGCAGAAGGTGGTGG + Intergenic
1035287773 7:157817044-157817066 CCTCTCGCTGCTCAAGGTGGAGG + Intronic
1037529361 8:19758002-19758024 CCTGTGTGTGCTGGAGGTGGCGG - Intronic
1038316823 8:26491396-26491418 CCTTTTTCTGCTGTAGATGGTGG - Intronic
1042992796 8:74659471-74659493 CATTTTTTTGCTGAAGCTGGAGG + Intronic
1043050744 8:75382363-75382385 CTTTTCTGAGATGAAGGTGGGGG + Intergenic
1045982440 8:108206481-108206503 CCATTCTAGGCTGGATGTGGTGG + Intronic
1048266064 8:132988205-132988227 CCTGTCTATGGTGAATCTGGGGG - Intronic
1049376359 8:142291203-142291225 CCTTTCTGAGATGAGGGTGGTGG - Intronic
1050150748 9:2617241-2617263 ACTTTCTATGCTGAGGCTGTGGG + Intergenic
1051141110 9:13979796-13979818 TCTTTCTCTGCTGAAGGAGAAGG - Intergenic
1052799797 9:32956567-32956589 CCTTTCTTTCCAGAAGGTGGTGG - Intergenic
1061233568 9:129328930-129328952 CCTTCCGTTGCTGAAGGGGGCGG + Intergenic
1189516161 X:41715330-41715352 CCTTTCTTGGCTGGACGTGGTGG + Intronic
1191828440 X:65390636-65390658 ACATCCCATGCTGAAGGTGGGGG - Intronic
1194278124 X:91913052-91913074 CCTTTCTAGGTTAGAGGTGGAGG - Intronic
1195094272 X:101490425-101490447 CCATACTGTGCTTAAGGTGGGGG + Exonic
1195636158 X:107118370-107118392 CCTTTCTCAGGTGGAGGTGGAGG + Intronic
1198493942 X:137171492-137171514 CTTTTCTCAGCTGAATGTGGGGG + Intergenic
1200595464 Y:5135127-5135149 CCTTTCTAGGTTAGAGGTGGAGG - Intronic
1202369692 Y:24188368-24188390 CCCGTCCATGCTGAAGGTGGTGG - Intergenic
1202501093 Y:25481749-25481771 CCCGTCCATGCTGAAGGTGGTGG + Intergenic