ID: 961372741

View in Genome Browser
Species Human (GRCh38)
Location 3:126441300-126441322
Sequence CAGCCTTTCTATGCTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372741_961372746 12 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372741_961372752 25 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353
961372741_961372748 16 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372741_961372747 13 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372741_961372745 11 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372741_961372743 -4 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372741 Original CRISPR CAGCCTTTCTATGCTGAAGG TGG (reversed) Intronic
900791972 1:4686798-4686820 CAGCTTTTGCAGGCTGAAGGGGG - Intronic
901326080 1:8365971-8365993 CAGCCCTTCTCTTCTGCAGGGGG - Exonic
907566956 1:55444381-55444403 TGGCCTTTCTATCCTGAAGCAGG - Intergenic
910359828 1:86404527-86404549 CAGCATTTCTAGGCTGAGGGTGG + Intergenic
915822572 1:159041003-159041025 CAGCCTTTCAGTGATGGAGGAGG + Intronic
919314104 1:195948809-195948831 CAGCCTTTCTATGCTCTTGGGGG - Intergenic
920303633 1:205004968-205004990 CAGCCCTTCTGTGCTGGGGGCGG + Intronic
921839116 1:219809648-219809670 CAGCCATTATGTTCTGAAGGTGG + Intronic
922309617 1:224376058-224376080 CATCCTCTGTATGTTGAAGGTGG + Exonic
922967357 1:229701794-229701816 GAGCCTTTCTATAATGATGGAGG + Intergenic
923233552 1:232010943-232010965 CAGCCATTCTTTCCTGAAGCAGG - Intronic
1063549733 10:7019202-7019224 AAGGCTTTCTCTGCTGAAGCTGG + Intergenic
1064336833 10:14450928-14450950 GAGCATTTCTATTGTGAAGGAGG - Intronic
1065755330 10:28925332-28925354 CAGCCTTGCTATGCTGATTTTGG - Intergenic
1069634132 10:69914977-69914999 CAGCCTTTGCAGGCTGAAAGCGG - Intronic
1070812729 10:79306407-79306429 CAGAATTTCTGTGCTGATGGTGG + Intronic
1072358943 10:94640083-94640105 CAGCCTTGCTGAGCTGCAGGGGG + Intergenic
1072560942 10:96573475-96573497 CAGCATATCCATGCTGGAGGTGG + Intronic
1072737287 10:97887762-97887784 CAGCCTTTCTACCCTGGAGCAGG + Intronic
1074745724 10:116529966-116529988 CAGCCTTTAAGTACTGAAGGGGG - Intergenic
1074818974 10:117165308-117165330 ATGCCTTTCTATCCTAAAGGAGG - Intergenic
1078650510 11:13186514-13186536 CTCCCTCTCTTTGCTGAAGGAGG + Intergenic
1078713702 11:13819172-13819194 CAGCTTTTATAGGCTGAATGAGG + Intergenic
1081578413 11:44334336-44334358 CAGCCTTTCTGGGGTGACGGAGG + Intergenic
1082054986 11:47806974-47806996 CAACCTTTCTATGGCAAAGGTGG + Intronic
1085458936 11:76681551-76681573 CAGCCTCTCCCTGCAGAAGGGGG - Intergenic
1085887490 11:80537294-80537316 CAGAATTTCTATGAGGAAGGAGG + Intergenic
1088089564 11:106022170-106022192 GAGCGGTTCTATGCTGGAGGAGG - Exonic
1089296099 11:117469275-117469297 CAGCCCTTCTATGCCCATGGAGG + Intronic
1089685782 11:120145912-120145934 CAGCCTTGTTATTCTGATGGTGG - Intronic
1090068943 11:123527035-123527057 GAGCCTTTCTCCTCTGAAGGAGG - Intronic
1090095964 11:123741720-123741742 GAGCCTTTCTAGGCTGTGGGAGG + Intergenic
1091003660 11:131932605-131932627 CAGGCTTTCTGTGCAGAAGCTGG - Intronic
1093196864 12:16139987-16140009 CAGTTTTTCTGTGCTTAAGGTGG + Intergenic
1093241136 12:16676363-16676385 CAGGCTTTCTATTCTGAAATAGG + Intergenic
1095445524 12:42278412-42278434 CAGCCTTTCTACTCTAAATGTGG - Intronic
1096648762 12:53051845-53051867 CAGCTTTCCTAGGCTGAAGGTGG - Exonic
1098433790 12:70448262-70448284 CAGCCCTTCGCTGCTGGAGGTGG + Intergenic
1098566220 12:71939521-71939543 CAGGCTTTGTAAACTGAAGGGGG - Intronic
1098740877 12:74171697-74171719 CAGCCGGTCAATGCTGAAGCCGG - Intergenic
1100685399 12:96982098-96982120 CAGCCTTTAAATGCTGAAAGAGG + Intergenic
1103595874 12:122023925-122023947 CCGCCTTTCTCTGCTCGAGGAGG + Intronic
1106653515 13:31717643-31717665 CTGCCCTTCTACCCTGAAGGAGG + Intergenic
1107698033 13:43019878-43019900 CATCCTTTCTTTGCTGAGGAGGG + Intergenic
1108689631 13:52849079-52849101 CAGACTTGCTCTGCTGAATGAGG + Intergenic
1110528912 13:76573775-76573797 CAGGCTTTTTCAGCTGAAGGGGG + Intergenic
1114718799 14:24857819-24857841 AAGCCTTTCTGTGCTAAAGATGG + Intronic
1116221724 14:42096197-42096219 CAGGCTGTTTATGCTGAGGGGGG + Intergenic
1118293850 14:64550370-64550392 CAGCCTTTCTATCCAGAGCGGGG - Intronic
1122804280 14:104248773-104248795 CCAACTTCCTATGCTGAAGGCGG - Intergenic
1125614192 15:40995144-40995166 CTGCATTTCTAGGCTGAACGCGG - Intronic
1128136177 15:65265248-65265270 CTGCTTTTATATGCTGATGGAGG - Intronic
1128908018 15:71485564-71485586 CAGCCTTGCTGGGCAGAAGGAGG + Intronic
1130981744 15:88816849-88816871 CAGCCTCTGTCTCCTGAAGGTGG - Intronic
1131069933 15:89459794-89459816 GAGTCTTTACATGCTGAAGGGGG + Intergenic
1131275955 15:90981030-90981052 CTGGCTTTCTATGCTGTAGCTGG - Exonic
1131623597 15:94094181-94094203 CAGGTTTTCTATGCGGAAGTTGG - Intergenic
1131656101 15:94460783-94460805 CAGCCTTCCTGTGCTGCAGCTGG - Intronic
1132847678 16:2008014-2008036 CCGCCTTACTGGGCTGAAGGAGG - Intronic
1134354748 16:13471090-13471112 CAGCCTTTCTATCCTCCAGAAGG - Intergenic
1134658557 16:15966445-15966467 CAGCCTTACAAGGCTGATGGAGG - Intronic
1135631295 16:24037716-24037738 CAGCATATCTATGATTAAGGGGG - Intronic
1136563215 16:31053483-31053505 TAGCCTTTCTAAACTGAAAGAGG - Intergenic
1137619472 16:49867029-49867051 CCGCCTTTGTCTGCTGCAGGAGG - Intergenic
1137645321 16:50068111-50068133 CAGCCTCTGTATGCTGTGGGAGG - Intronic
1139109927 16:63877647-63877669 CAGCTTTTCTAAACAGAAGGTGG + Intergenic
1141320581 16:83004931-83004953 CAGCCTGGCTATGGTGCAGGAGG - Intronic
1142196209 16:88740424-88740446 CAGCCCCTCCATGCTGATGGGGG - Intronic
1143100350 17:4501192-4501214 CACCCTTTCTCAGCTGAAGAAGG + Intronic
1144429496 17:15178226-15178248 CAGCCTTTCTCCCCTGAAGTAGG + Intergenic
1148186242 17:45646393-45646415 CAGCCTTCCGAGGCTGCAGGAGG + Intergenic
1149412957 17:56427814-56427836 CAGCCTATCAATGCAGAAGCTGG - Intronic
1150492321 17:65583005-65583027 CAGCTTTTAAATGCTGAAGTTGG - Intronic
1153138193 18:1941712-1941734 CAGCTTTTCCAGGCTGAGGGGGG - Intergenic
1153681971 18:7509440-7509462 CAGCCTCTAGAAGCTGAAGGTGG + Intergenic
1154106648 18:11529239-11529261 GAGCCTTTCTATGCTGGAAGGGG + Intergenic
1156345900 18:36256990-36257012 CACCCTTTCTCTGGTGAATGAGG + Exonic
1157498003 18:48170304-48170326 CAGTCTTCCTATTCTGCAGGGGG + Intronic
1158402172 18:57131075-57131097 GAGCCTTTCTTTGCTAAATGGGG - Intergenic
1158491758 18:57916438-57916460 CAGCCTCTCAAAGCTGAGGGAGG + Intergenic
1164386298 19:27773445-27773467 TTGCCTTTCCATGCTTAAGGTGG + Intergenic
1164386342 19:27773758-27773780 TAGCCTTACCATGTTGAAGGTGG + Intergenic
1164747573 19:30627502-30627524 AAGGCTTTCTATGCTGGAGCTGG + Intronic
1167964160 19:53129814-53129836 CAGCACTTCGAGGCTGAAGGAGG + Intronic
1168019439 19:53598207-53598229 CAGACTTTCTATGCAGTATGTGG + Intergenic
925431026 2:3793354-3793376 CAGGCTTCCGATGCAGAAGGCGG - Intronic
926803382 2:16682528-16682550 CAGCCTTGCAATGCTGTAGAAGG + Intergenic
929097827 2:38280675-38280697 CAGCATTTCTGTGATGAAAGTGG - Intergenic
931008278 2:57878144-57878166 GAGGCTTTCTATGCAGATGGGGG + Intergenic
933767155 2:85717968-85717990 CAACCTTTCCATGCTCTAGGAGG + Intergenic
935886477 2:107624883-107624905 CACCCTTTCTAGGCTGAGTGTGG - Intergenic
936574693 2:113643153-113643175 CAGCCTCTTTATGCTGAAATAGG - Exonic
937476876 2:122223524-122223546 CAGTCTTTCTGTTCTAAAGGAGG - Intergenic
938289592 2:130142265-130142287 CAGCCCTGCCAGGCTGAAGGAGG - Exonic
938466938 2:131530673-131530695 CAGCCCTGCCAGGCTGAAGGAGG + Exonic
940976911 2:159956548-159956570 CAACATTTCTGTGCTGAAGAAGG - Exonic
942429737 2:175898021-175898043 CTGCCTTTCTGTCCTGAAGCTGG - Intergenic
948207032 2:236167891-236167913 CAGCGAGTCTATGCTGAAGGCGG + Exonic
948425434 2:237884284-237884306 CAGCCTTGGTTTGCTGATGGAGG + Intronic
948516166 2:238505130-238505152 AAGCCATTTTAGGCTGAAGGTGG - Intergenic
1168805625 20:670746-670768 CAGTCTTTGATTGCTGAAGGAGG - Intronic
1169409392 20:5354614-5354636 GACCCTGTCTATGCAGAAGGAGG + Intergenic
1169785958 20:9359426-9359448 CAGCCCTTCTAAGAAGAAGGGGG - Intronic
1176302756 21:5106368-5106390 GAGCCTTTCTATGGCGAATGCGG - Intergenic
1176306975 21:5128676-5128698 CAGCCTTGCTCTGCGGATGGCGG - Intergenic
1176454054 21:6892373-6892395 CAGCCTTCCTCTGTAGAAGGAGG + Intergenic
1178420497 21:32439270-32439292 CATCCTTCCTTTGCTGACGGTGG - Intronic
1179850084 21:44133354-44133376 CAGCCTTGCTCTGCGGATGGCGG + Intergenic
1179854268 21:44155555-44155577 GAGCCTTTCTATGGCGAATGCGG + Intergenic
1181634330 22:24167368-24167390 TTGCCTTTCTATCCTCAAGGAGG + Intronic
1182420782 22:30247555-30247577 CAGCATTTCCATTCTGAAGCAGG + Intergenic
1185425481 22:50767723-50767745 CAGCCTCTTTATGCTGAAATAGG + Exonic
951826692 3:26876242-26876264 CAGCTTTACTATGCTGCAGTGGG - Intergenic
956304048 3:67804871-67804893 CTGCATTTCTATGCAGGAGGAGG + Intergenic
956645204 3:71448336-71448358 CAGCCTTTCTTTGCAGAATGAGG - Intronic
957051221 3:75413814-75413836 CATCCTTTCTTTGCTGGCGGTGG + Intergenic
960164641 3:114387633-114387655 CAGCCTTACTATGATGCAGATGG - Intronic
961372741 3:126441300-126441322 CAGCCTTTCTATGCTGAAGGTGG - Intronic
961883512 3:130080239-130080261 CATCCTTCCTTTGCTGACGGTGG + Intergenic
961952192 3:130761892-130761914 CAGCCAGTGTGTGCTGAAGGAGG + Intergenic
962684975 3:137838480-137838502 CAGTCTACCTATGCTGATGGAGG - Intergenic
965633433 3:170756673-170756695 GAGCCTTTCTATTTTGAAGATGG - Intronic
966101067 3:176269530-176269552 CAGCCTTTCTCTGCTGTACCAGG - Intergenic
969227301 4:5807421-5807443 CTGCCTATCCATGCTAAAGGTGG + Intronic
969528828 4:7718308-7718330 CAGCCTGTCCAGACTGAAGGAGG + Intronic
969821254 4:9722073-9722095 CATCCTTCCTTTGCTGACGGTGG - Intergenic
975140632 4:70914878-70914900 CATCCTTTATATGCTACAGGAGG - Intronic
977561320 4:98536729-98536751 CAGCCTTTCTGAGCTGCAGTGGG + Intronic
978543596 4:109846139-109846161 CAGCGTTTCTATGCTCAATTTGG + Intergenic
979071419 4:116212726-116212748 CAGCCTCTTCATGCTTAAGGTGG - Intergenic
979544401 4:121923212-121923234 CATCCTTTCTATGCTGATATGGG + Intronic
985649270 5:1099726-1099748 CAGCCTTTCTAAGCTGTGGTGGG - Intronic
985895324 5:2747401-2747423 CAGCTTTTCTTTCCTTAAGGGGG - Intronic
989400278 5:41000918-41000940 CAGCCTTCTTTTGCTGAAGCGGG - Intronic
993591371 5:89799731-89799753 CAGATTTTCTTTGCTCAAGGTGG - Intergenic
994161603 5:96562939-96562961 CTGCCCTTCTCTCCTGAAGGAGG + Intronic
995799859 5:115982269-115982291 CAGCCTTATGATGGTGAAGGAGG + Intronic
1002955385 6:1857632-1857654 CATCCTTTCAAGGCTGAGGGAGG - Intronic
1006494891 6:34415464-34415486 CTGCCTATCAATACTGAAGGTGG + Intronic
1008479392 6:51969189-51969211 CAGCCTTTAATTGCTGAAAGTGG + Intronic
1010006247 6:70998424-70998446 CAGCCTTGCTGAGCTGCAGGGGG - Intergenic
1010480098 6:76340867-76340889 CAACCTTTGTATGCTGTTGGTGG + Intergenic
1011436360 6:87342266-87342288 CATCCTTTCTTTGTTGAATGAGG + Exonic
1013987131 6:116208276-116208298 CAGCTTCTCTCTTCTGAAGGAGG + Intronic
1016516949 6:144904485-144904507 TAGACTTTTTATGCTGAAGCTGG - Intergenic
1017228466 6:152046814-152046836 CAGCCTTTTCATGCTGAATTTGG - Intronic
1017263650 6:152416898-152416920 CAGCCTTTCCCTGCAGGAGGTGG + Exonic
1017864885 6:158434756-158434778 CAGCATTTCCATGCTGAGTGTGG + Intronic
1018102926 6:160457239-160457261 CAGCTGTTCCATGCTGAAGGTGG - Intergenic
1018132838 6:160748948-160748970 CAGCTGTTCCATGCTGGAGGTGG + Intronic
1019312447 7:369371-369393 CAGCCTCTCCGTGCTGCAGGTGG + Intergenic
1020769443 7:12369840-12369862 CAGCCTTCCTATGCTGGAGTTGG + Exonic
1021834903 7:24660426-24660448 CAACCTTTCTATGAAAAAGGAGG - Intronic
1024188641 7:46982084-46982106 AAGCTTTAATATGCTGAAGGTGG + Intergenic
1028107854 7:86901840-86901862 CAGACTTTCTCTGCTGAGGATGG + Intronic
1031967172 7:128034824-128034846 CAGCCCTTCTGAGCTGAAAGTGG + Intronic
1032151482 7:129433760-129433782 CTGCCCTTCTCTGCTGTAGGGGG - Intergenic
1033966149 7:146976948-146976970 CCGCCTTTCTGTCCTGGAGGGGG - Intronic
1035797535 8:2372982-2373004 CACCATTTCTAAGCTGAATGTGG - Intergenic
1037772115 8:21808396-21808418 CAGCATTGCTATGATGGAGGAGG + Intronic
1039925998 8:41932952-41932974 CAGCTTGGCTAGGCTGAAGGTGG + Exonic
1040669797 8:49676207-49676229 CTGCCTTTCTGTCCTGAAGCTGG + Intergenic
1043419145 8:80081400-80081422 GAACCTTTCTATGCTGACTGTGG + Intronic
1044982460 8:97730602-97730624 CAGCCTTTCCCTGAGGAAGGGGG + Intergenic
1045212138 8:100109077-100109099 CAGCCTTTCTGAGCTGCAGTGGG - Intronic
1046764585 8:118056145-118056167 AAGCCATTCTGTGCTGCAGGTGG + Intronic
1052799799 9:32956570-32956592 CTGCCTTTCTTTCCAGAAGGTGG - Intergenic
1059953909 9:119496296-119496318 TAACCTTTCTATGATGTAGGTGG + Intronic
1061233566 9:129328927-129328949 CGGCCTTCCGTTGCTGAAGGGGG + Intergenic
1061533666 9:131234213-131234235 CAGCCTTTATATTCTGTATGTGG + Exonic
1186344263 X:8675337-8675359 CTGCCTTTCTCTGCTGAGCGTGG - Intronic
1188221202 X:27543649-27543671 CTGCCTTTCTGTGCTGAACCTGG - Intergenic
1190413472 X:50159569-50159591 GAGCCTTTCTGTGCTAAAAGTGG - Intergenic
1196308043 X:114127540-114127562 CAGCCTTGCTGAGCTGAAGTGGG + Intergenic