ID: 961372742

View in Genome Browser
Species Human (GRCh38)
Location 3:126441303-126441325
Sequence TAGCAGCCTTTCTATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372742_961372743 -7 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372742_961372748 13 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372742_961372753 29 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372753 3:126441355-126441377 GGGGTGGCTGAGACGGCCTGCGG 0: 1
1: 0
2: 3
3: 31
4: 340
961372742_961372747 10 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372742_961372752 22 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353
961372742_961372745 8 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372742_961372746 9 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372742 Original CRISPR TAGCAGCCTTTCTATGCTGA AGG (reversed) Intronic
905304965 1:37011376-37011398 TAGCTGCCTTTCGCTGCTGAGGG - Intronic
905325227 1:37147020-37147042 TAGAACCCTTGCTGTGCTGAAGG + Intergenic
905933405 1:41805802-41805824 AAGCAGCCCTTCCATCCTGATGG + Intronic
906786716 1:48622434-48622456 TTGCAAACTTTCTATGCTCAAGG + Intronic
910359827 1:86404524-86404546 ATGCAGCATTTCTAGGCTGAGGG + Intergenic
918066080 1:181102651-181102673 TATCTGCATTTCTATGGTGAGGG + Intergenic
919314107 1:195948812-195948834 TCTCAGCCTTTCTATGCTCTTGG - Intergenic
919609383 1:199726417-199726439 TAGATGCTTTTCTTTGCTGAAGG + Intergenic
921437465 1:215141886-215141908 TTTCAGCTATTCTATGCTGATGG + Intronic
921839115 1:219809645-219809667 TAGCAGCCATTATGTTCTGAAGG + Intronic
922687773 1:227659586-227659608 TATCAGAGTTTCTATGCTTATGG + Exonic
923139559 1:231149652-231149674 CAGCAGCCTTTCAAGGCTGGGGG + Intergenic
923277745 1:232413423-232413445 TAGCAGTCATTCTGTTCTGAAGG + Intronic
924687522 1:246310342-246310364 CAGCAGCCATTCAATCCTGATGG + Intronic
1066714140 10:38268346-38268368 TTGTAGCATTTTTATGCTGAAGG - Intergenic
1067727979 10:48787341-48787363 CAGCAGCCTGTATGTGCTGAAGG + Intronic
1069181855 10:65370768-65370790 TTGCAGACTTTCTAGGCTTAAGG - Intergenic
1070245901 10:74730951-74730973 TTGCAGCTTTTCCAGGCTGAGGG - Intergenic
1071136396 10:82459044-82459066 TAGCAGCCCTGCCATGGTGATGG - Intronic
1072358940 10:94640080-94640102 TAGCAGCCTTGCTGAGCTGCAGG + Intergenic
1072560941 10:96573472-96573494 TAGCAGCATATCCATGCTGGAGG + Intronic
1078418274 11:11183945-11183967 TAGCAGCAGTTCTATGCAAAAGG - Intergenic
1085387676 11:76166361-76166383 TAGCAGCCCTTGTGTGCTGCAGG - Intergenic
1085880551 11:80462789-80462811 GAGCAGCTGTGCTATGCTGAGGG - Intergenic
1086498625 11:87429412-87429434 TAGGAAGCCTTCTATGCTGATGG + Intergenic
1087135946 11:94720269-94720291 AAGAATCCTTTATATGCTGAGGG - Intronic
1089073092 11:115716359-115716381 TAGGAGCCTTTCTAAGGGGAAGG + Intergenic
1090095963 11:123741717-123741739 TAGGAGCCTTTCTAGGCTGTGGG + Intergenic
1091329508 11:134720075-134720097 TTGCAGCCGTTCAGTGCTGAGGG + Intergenic
1091897430 12:4116756-4116778 TAGCAGCCTCTCTGTGCTAGAGG + Intergenic
1100852437 12:98727414-98727436 TAGCAGCCTTTTTACTCTGCTGG - Intronic
1101368858 12:104105507-104105529 GAGAAGTCTTTCTATACTGAGGG + Exonic
1104153460 12:126107501-126107523 TTGCATCGTTTCTATTCTGATGG + Intergenic
1106340944 13:28825681-28825703 TTACAGCCTTTCTATACTCATGG + Intronic
1107682697 13:42867650-42867672 TAGCACCCTTTCTTTGATAAGGG - Intergenic
1110390498 13:74968059-74968081 CAGAAGCCTTTCTAGGCAGAGGG - Intergenic
1112451069 13:99509957-99509979 TAACAGCCTATCTTAGCTGAAGG - Intronic
1114317962 14:21524856-21524878 CAGCATCCTTTCTCTGCTGGAGG - Exonic
1114459186 14:22876095-22876117 TACCAGACTTTCTGTGCTGATGG + Exonic
1114912942 14:27223168-27223190 TAGCAACTTTTCTATCCTGCAGG - Intergenic
1115994036 14:39176956-39176978 TAGTATCCTTTCTCTGCTGGAGG + Intronic
1116677677 14:47926664-47926686 TAGCAGCATTTACAAGCTGACGG - Intergenic
1121297207 14:92838209-92838231 TAGCAGCCTTTTTAGGCACACGG - Intronic
1122016108 14:98798067-98798089 TACCAGGCTTTCTATGTTGTGGG - Intergenic
1123152220 14:106193417-106193439 TGGAAGCTTTTCTAGGCTGAGGG + Intergenic
1123172329 14:106385821-106385843 TGGAAGCTTTTCTAGGCTGAGGG + Intergenic
1123400603 15:19981364-19981386 TGGAAGCTTTTCTAGGCTGAGGG + Intergenic
1124635628 15:31363139-31363161 AAGCAGGCATTCTTTGCTGATGG - Intronic
1125500700 15:40238924-40238946 TATCTGCCTTTCTTTGCTGAAGG - Intronic
1128136178 15:65265251-65265273 TAGCTGCTTTTATATGCTGATGG - Intronic
1131532662 15:93206985-93207007 GAGCTGCCTTTCTAGGCTGCTGG - Intergenic
1133085879 16:3363022-3363044 TTGCTGCCTTTCTATTCAGAGGG - Intergenic
1133532622 16:6669755-6669777 TAGGACCTTTTCTATTCTGAAGG - Intronic
1137874442 16:51982341-51982363 TTGCTGACTTTTTATGCTGAAGG + Intergenic
1138590243 16:57995772-57995794 AAGCAGCCTGTCTCTGCTAAGGG - Exonic
1139560532 16:67738846-67738868 TAGCAGGCTTTCTTTGCGGGTGG - Intronic
1140127186 16:72127806-72127828 TTGCTGCCTTTCTGTGATGATGG - Intronic
1160458219 18:79018130-79018152 AAGCTGCTTTTCTTTGCTGAAGG + Intergenic
1168122790 19:54262228-54262250 CAGCATCCTTTCACTGCTGAGGG + Intronic
928918071 2:36495186-36495208 TACAAGCCTTTCTAGGATGATGG - Intronic
929458727 2:42085575-42085597 TGGGAGCCTATCTAGGCTGATGG + Intergenic
932263426 2:70345828-70345850 TGGCTGCCTCTCTCTGCTGAAGG + Intergenic
935115001 2:100127772-100127794 TAGCTCCCTTTCTAAGCTGGAGG + Intronic
937397101 2:121546809-121546831 GAGCAGCCATGCTATGCTCAGGG - Intronic
937416104 2:121715886-121715908 TGGCAGCTTTTTTATTCTGAAGG - Intergenic
938473035 2:131583342-131583364 TAGCAGACTTTGTATGCTTGAGG + Intergenic
938999728 2:136720476-136720498 CAGCAACCTTTCTAGGGTGATGG - Intergenic
944886385 2:204066602-204066624 TAGCAGACTTTCTCTGATGCTGG + Intergenic
946703044 2:222431727-222431749 TGGCTGCCTTTCTTTGCTAAGGG - Intronic
946738389 2:222777027-222777049 TAGCGGCCTCTCTATGAAGAGGG - Intergenic
1170693463 20:18636203-18636225 CAGCATCCTTTTTATTCTGAAGG + Intronic
1170694573 20:18646847-18646869 CATCAGTCTTTGTATGCTGATGG + Intronic
1171138827 20:22723194-22723216 TGGCAGCCCTTCTCTGCTGGTGG - Intergenic
1172895979 20:38300284-38300306 TAACAGCCTTGCTGTGCTGCGGG + Intronic
1173392024 20:42643953-42643975 TAGAAGGCTTTCTTTCCTGATGG - Intronic
1175577085 20:60068212-60068234 TAGCAGCTTTTGTATGAGGAGGG + Intronic
1178409074 21:32348923-32348945 CAGCAGCCTTTCTGTCCTGTTGG - Intronic
1178746065 21:35251415-35251437 TAGCTGCCTTGCTAGGCTGCTGG - Intronic
949607725 3:5672656-5672678 TAGTACCCTGTCTATGCTGGTGG + Intergenic
957350023 3:79012688-79012710 TAGCAGCCTGTTTTGGCTGAAGG + Intronic
959831758 3:110871372-110871394 TTGCATCCTCTCTATGGTGATGG - Intergenic
961040825 3:123676878-123676900 TAGCAGTCTATATAAGCTGATGG - Intronic
961372742 3:126441303-126441325 TAGCAGCCTTTCTATGCTGAAGG - Intronic
961837086 3:129671141-129671163 TGGCAGCCTTTGTGCGCTGAGGG + Exonic
963075852 3:141345670-141345692 AAGCAGCCTTTCTGAGCTCAGGG - Intronic
970158118 4:13161927-13161949 AAACAGCCTTTTTATGCAGAAGG + Intergenic
971406293 4:26322876-26322898 TACCAGGATTACTATGCTGAAGG + Intronic
975761284 4:77622919-77622941 TAGCACCCTTTTTATCCTGCTGG + Intergenic
979317763 4:119285187-119285209 TGGCAGCTTTTCTGTGATGAAGG + Intronic
983558149 4:169076711-169076733 CAGCAGCCCGTCTATGCTCAGGG - Intergenic
986666461 5:10108791-10108813 CAGCTGCCTTTCCATCCTGAAGG + Intergenic
988291870 5:29297447-29297469 TAGAAGCTTTTGTATGCTCATGG - Intergenic
990801840 5:59613029-59613051 GAGCAGCCTCACTCTGCTGAGGG + Intronic
992729026 5:79639619-79639641 TAACACCATTTTTATGCTGATGG + Intronic
994507936 5:100665332-100665354 CTGCAGATTTTCTATGCTGAGGG + Intergenic
1004170403 6:13291495-13291517 GAACAGCCTTTCTACGCTGCTGG - Intronic
1004425468 6:15504133-15504155 CAGCAGCCTTTGTCAGCTGAGGG + Intronic
1004767293 6:18744583-18744605 TCACAGCTTTTCCATGCTGAAGG - Intergenic
1005309578 6:24546643-24546665 TAGCAAGCTTTCTGTGCTGACGG - Exonic
1011370587 6:86633290-86633312 GAGCAGCTGTGCTATGCTGAGGG + Intergenic
1013190405 6:107800146-107800168 TAGGAGCATATCCATGCTGAGGG - Intronic
1017731125 6:157317085-157317107 TAACAGCATGTATATGCTGATGG - Intronic
1018336953 6:162802615-162802637 TAGGAGCCTTTCTACCCTGTGGG - Intronic
1022122504 7:27323182-27323204 TAGGAGGCTTTCTGTGCTCAAGG + Intergenic
1022373232 7:29789561-29789583 TAGCAGCCTGTCTAGCCTGCTGG - Intergenic
1026052025 7:66954931-66954953 TAGAAGACTTCTTATGCTGATGG - Intronic
1026552394 7:71379678-71379700 TACCACCCTGTCTTTGCTGAAGG - Intronic
1029666661 7:101999438-101999460 AAGCAGCCTTTCAAAGCTCATGG - Intronic
1030419500 7:109290118-109290140 AAGCATCCTTTTTCTGCTGAGGG + Intergenic
1032201719 7:129826693-129826715 TAGCAGCCTCTCCGTGCTGCAGG - Intergenic
1036588606 8:10147674-10147696 TTACAGCCTTTCCATGCAGATGG - Intronic
1038584146 8:28774602-28774624 TAGCAGCCTCTCCAGGCTCATGG + Intronic
1039482767 8:37887188-37887210 AAACAGCCTTTCCATGCTGCTGG - Intronic
1041561684 8:59225890-59225912 CAGCAGCTGTGCTATGCTGAGGG - Intergenic
1042580877 8:70278386-70278408 TAGTAGACTTTCTATATTGATGG - Intronic
1043483496 8:80676294-80676316 AAGGTGCGTTTCTATGCTGATGG + Intronic
1044731421 8:95231602-95231624 CAGCAGCCTTTCTAGGGTCATGG - Intergenic
1045356196 8:101391219-101391241 TATCAGCCTTCCTGTGTTGAAGG + Intergenic
1045947508 8:107812883-107812905 TAGCAGTCAGTATATGCTGATGG - Intergenic
1049534386 8:143171460-143171482 AAGCCTCCTTTCTATGCTCAAGG + Intergenic
1050148116 9:2591707-2591729 CTGAAGCCTTTCCATGCTGAGGG + Intergenic
1053392642 9:37746625-37746647 TAGCAGCCTCTATAAACTGATGG - Exonic
1054833581 9:69652474-69652496 AAGCAGCCTGTCTAAGCTGGAGG + Intronic
1056902435 9:90612643-90612665 TAGGAGCCTTGCTACCCTGAGGG - Exonic
1062157510 9:135061382-135061404 TAGCAGCCCTGCAATGCTGTGGG + Intergenic
1189749830 X:44209409-44209431 TATCAGTTTTTCTACGCTGATGG - Intronic
1190753485 X:53381470-53381492 CAGCAGGCATTCTAGGCTGAGGG - Intronic
1191797884 X:65041698-65041720 TAGTAGTCTTTGTATGTTGATGG + Intergenic